PGML1286

Marker Overview
NamePGML1286
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(AAAT)5
Primer 1PGML1286_F: TGAACATTTCAGTCGGTTGG
Primer 2PGML1286_R: TTCAGCAAGCCAACTAATTACA
Product Length184
Publication[view all]
CommentBAC_ID=FITC13196.b1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x 7235, RIL (2015)Y7-RIL_chr23N/AAD_chr.2367PGML1286View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr23N/AAD_chr.2361.9PGML1286View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr23N/ADt.09131.05PGML1286-131.047View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML1286_RPGML1286.PGML1286_RGossypium raimondiiprimer
PGML1286_FPGML1286.PGML1286_FGossypium raimondiiprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
micronaireqMIC.Y7-RIL_ch23.bb09.1Gossypium hirsutumQTL
micronaireqMIC.Y7-RIL_ch23.bb09-12.1Gossypium hirsutumQTL
micronaireqMIC.Y7-RIL_ch23.bb12Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML1286PGML1286Gossypium raimondiimarker_locus
PGML1286PGML1286-131.047Gossypium raimondiimarker_locus


Sequence
>PGML1286 ID=PGML1286|Name=PGML1286|organism=Gossypium raimondii|type=genetic_marker|length=184bp
TGAACATTTCAGTCGGTTGGCTTTATGGGCTGTTTAATTTGCAGCCTATG
TTTTTGTTTACAGCCTAGTGCAGTAATGTTATGGGCTGTTTTTCTTGTGT
TTCCTTTTTATTATAATACCCCAGTCAATTATTCAAAAAAATAAATAAAT
AAATAAATACATTGTAATTAGTTGGCTTGCTGAA