PGML0888

Marker Overview
NamePGML0888
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(GAA)15,(AAGTAG)3
Primer 1PGML0888_F: CGACAAGAGACAACGAAGGG
Primer 2PGML0888_R: TCGGTACCCGAGTCTAATGTC
Product Length329
Publication[view all]
CommentBAC_ID=FITB2890.y2
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr14N/AAD_chr.1473.6PGML0888View
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr14N/AAD_chr.1438.8PGML0888View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr14N/AAD_chr.1436.5PGML0888View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr14N/ADt.0275.79PGML0888-75.787View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML0888_FPGML0888.PGML0888_FGossypium raimondiiprimer
PGML0888_RPGML0888.PGML0888_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML0888PGML0888Gossypium raimondiimarker_locus
PGML0888PGML0888-75.787Gossypium raimondiimarker_locus


Sequence
>PGML0888 ID=PGML0888|Name=PGML0888|organism=Gossypium raimondii|type=genetic_marker|length=329bp
CGACAAGAGACAACGAAGGGGAATGGTTAGAGTCGAGGTTCGATGATTCA
TCGTCTCTATATGTTGCTCTTAATACTTCCATATGTTGCTCTTTGAGAAG
AAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAAAAGACGAA
GTAGAAGTAGAAGTAGTAGAAGAAGAAGAAATGATAGAAAAATGAGGGGA
GGAGAAAAGTTAAAAGAAAAAAATTAATTTTTTTACATTATGACATCACC
ATGACATCATATATACCACGTGTCAAAATCTTATTCTACCACGTGTCCTA
AACTTAACGACATTAGACTCGGGTACCGA