PGML0873

Marker Overview
NamePGML0873
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(GAAA)3
Primer 1PGML0873_F: CCTTTGGTTGGATTAGCTGC
Primer 2PGML0873_R: TGGAGCTCTGATTCTCATGTTT
Product Length178
Publication[view all]
CommentBAC_ID=FITB803.x2 1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr21N/AAD_chr.2113.7PGML0873View
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr21N/AAD_chr.21112.7PGML0873View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr11N/AAD_chr.11167.6PGML0873View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr11N/AAt.1134.53PGML0873-34.534View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML0873_RPGML0873.PGML0873_RGossypium raimondiiprimer
PGML0873_FPGML0873.PGML0873_FGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML0873PGML0873Gossypium raimondiimarker_locus
PGML0873PGML0873-34.534Gossypium raimondiimarker_locus


Sequence
>PGML0873 ID=PGML0873|Name=PGML0873|organism=Gossypium raimondii|type=genetic_marker|length=178bp
CCTTTGGTTGGATTAGCTGCGCCTGTTTTTAGCTTTCGAGGGGAAATAAT
GGTGACGAGTTTTCTTTTAAAGGAAAAAAGAAAGAAAGAAAAGCTTTTGA
TGTGATCTCAAAATCAGAATGAGCTTTTTAAGCTCTTTGGTTTTCTAGCA
TTTCCTAAACATGAGAATCAGAGCTCCA