PGML0372

Marker Overview
NamePGML0372
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(CTTT)5
Product Length288
Publication[view all]
CommentBAC_ID=FITB945.y2 1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr06N/AAD_chr.06139.8PGML0372View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr06N/AAD_chr.0652.2PGML0372View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr25N/ADt.06107.91PGML0372-107.911View
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML0372PGML0372Gossypium raimondiimarker_locus
PGML0372PGML0372-107.911Gossypium raimondiimarker_locus


Sequence
>PGML0372 ID=PGML0372|Name=PGML0372|organism=Gossypium raimondii|type=genetic_marker|length=288bp
ATACTGTCCGTTGGAAAGCGTCATCGAGATACAGCCCCGGAGAAAATTAT
GACTCGATAGAAACATATTAACTAACACTTGCAAATCACATGCATGAAAC
AAATGTTTACTGAAGCTTTTTCCTTTGTGTATTCAAATGCAGCACTTCAT
TTTTGCAACGGTCAAACTTTTTGGGTAGAATTATGTAATTAGCCCATCTT
TCTTTCTTTCTTTCTTTCTCATTTTAACCCTTCATTTTTTTTTATCTCCT
TCTCTAACTAGCCCTTAAACCAAGGACATAAGGCTTGA