NAU6179

Marker Overview
NameNAU6179
Genbank IDAC188200
TypeSSR
SpeciesGossypium hirsutum
GermplasmAcala Maxxa
Acala Maxxa
Source Typegenomic
Repeat MotifAT(9)
Primer 1NAU6179_F: ACATCGCCGAACATTTATTT
Primer 2NAU6179_R: AACCTTATTATGGGCATGGA
Publication[view all]
ContactZhang, Tian-Zhen
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAC188200
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr20N/AAD_chr.20114.04NAU6179View
2(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr20-3N/AAD_chr.2092.5NAU6179View
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr20N/AAD_chr.20131.8NAU6179View
4Yumian-1 x 7235, RIL (2015)Y7-RIL_chr20N/AAD_chr.20126NAU6179View
5CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr20N/AAD_chr.2039.9NAU6179View
6TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr20/D10N/AAD_chr.2099.5NAU6179-190View
7CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr20N/ADt.10114.29NAU6179-114.287View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU6179_FNAU6179_FGossypium hirsutumprimer
NAU6179_RNAU6179_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU6179NAU6179Gossypium hirsutummarker_locus
NAU6179-190NAU6179-190Gossypium hirsutummarker_locus
NAU6179NAU6179-114.287Gossypium hirsutummarker_locus


Germplasm
Stock NameType
Acala Maxxacultivar
Acala Maxxacultivar