HAU3150

Marker Overview
NameHAU3150
Genbank IDGR711473
TypeSSR
SpeciesGossypium spp.
Source TypeEST
Repeat Motif(ATTC)4
PCR ConditionAnnealing temperature: 55.3
Primer 1HAU3150_F: AGATCCCAAGCAAAACCCGA
Primer 2HAU3150_R: ATCATGGGGCGAGAGTCGGA
Product Length239
Publication[view all]
CommentPrimer data obtained in 2012
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGR709330
DB:genbankGR711473
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr09N/AAD_chr.09119.23HAU3150View
2(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr09-2N/AAD_chr.0934.3HAU3150View
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr09N/AAD_chr.0974.6HAU3150View
4DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr09-2N/AAD_chr.0931.01HAU3150View
5DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr09-4N/AAD_chr.0931.01HAU3150View
6DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr09-1N/AAD_chr.09-112.8HAU3150View
7CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr09N/AAD_chr.0965.6HAU3150View
8CCRI-36 x G2005, RIL (2016)CG-RIL_chr09N/AAD_chr.0930.75HAU3150View
9CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr09N/AAt.0994.44HAU3150-94.441View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU3150_FHAU3150_FGossypium spp.primer
HAU3150_RHAU3150_RGossypium spp.primer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber lengthqFL.CG-RIL_ch09.ay11.1Gossypium hirsutum x barbadenseQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU3150HAU3150Gossypium spp.marker_locus
HAU3150HAU3150-94.441Gossypium spp.marker_locus


Sequence
>HAU3150 ID=HAU3150|Name=HAU3150|organism=Gossypium spp.|type=genetic_marker|length=239bp
AGATCCCAAGCAAAACCCGATATCCTTAACCTTTTAAATTCATTCATTCA
TTCACTTCCTCTAGTTTCGTTTCCGTCCAACGTAACTACCACGCCGACCG
TCGTAACCACCGCCGTAAATTCTCCCAAAATGGCGAAACTACCCTTACAG
ATCCTCCTCCTCTTCCTCCTTTCCCTCATTTCCTCCTCCACCGCAGAGAT
CAAAACCCTAACCATCAACTCCGACTCTCGCCCCATGAT