HAU2605

Marker Overview
NameHAU2605
Genbank IDEX171805
TypeSSR
SpeciesGossypium spp.
Source SequenceEX171805.1
Source TypeEST
Repeat Motif(CTT)6
PCR ConditionAnnealing temperature: 57.1
Primer 1HAU2605_F: TGACGATCATACCCGCCCCA
Primer 2HAU2605_R: GGAAACAGCAGGGACACACCA
Product Length270
Publication[view all]
CommentPrimer data obtained in 2012
References
External references for this genetic_marker
DatabaseAccession
DB:genbankEX171805
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr17N/ADt.0332.8HAU2605View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr17N/AAD_chr.1755.3HAU2605View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr17N/ADt.0385.48HAU2605-85.476View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU2605_FHAU2605_FGossypium spp.primer
HAU2605_RHAU2605_RGossypium spp.primer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
EX171805.1EX171805.1Gossypium spp.sequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU2605HAU2605Gossypium spp.marker_locus
HAU2605HAU2605-85.476Gossypium spp.marker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM018217.1chromosomeCM018217.1:48957079..48957373 -
CM018204.1chromosomeCM018204.1:3867799..3868069 +
D03chromosomeD03:48676675..48676956 -
A03chromosomeA03:3725781..3726050 +
Sequence
>HAU2605 ID=HAU2605|Name=HAU2605|organism=Gossypium spp.|type=genetic_marker|length=270bp
TGACGATCATACCCGCCCCAACAACAATAACTCCCACTCTGCTTTCTCCA
AGGTTTCTACTTCTTCTTCTTCTTCTTCTCCCGCTTGTAATTAACAGTCA
ATGCTTCAATTTGTTGGACTAGGTTTGGGCAGCTATAGAATCAGGATTCT
GGGCATCTCTTGACATGGCAAGTGGTCGTTACTTGTGGAGGCATCTGGTT
TCCTCTAACTCCAAGCCTTCCTCTTGATTCTGCAAAAAAAACCATTCTTT
GGTGTGTCCCTGCTGTTTCC