HAU2577

Marker Overview
NameHAU2577
Genbank IDES811349
TypeSSR
SpeciesGossypium spp.
Source SequenceES811349.1
Source TypeEST
Repeat Motif(ATTT)5
PCR ConditionAnnealing temperature: 57.0
Primer 1HAU2577_F: GTCCAGCTAGCAACCCTGCAA
Primer 2HAU2577_R: TGGCGAAGCATGGGAGTGAC
Product Length350
Publication[view all]
CommentPrimer data obtained in 2012
References
External references for this genetic_marker
DatabaseAccession
DB:genbankES811349
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr12N/AAD_chr.1263.5HAU2577View
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr12N/AAD_chr.12142.8HAU2577View
3CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr12N/AAt.1290.2HAU2577View
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr12N/AAD_chr.127.1HAU2577View
5CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr12N/AAt.1273.04HAU2577-73.044View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU2577_FHAU2577_FGossypium spp.primer
HAU2577_RHAU2577_RGossypium spp.primer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
ES811349.1ES811349.1Gossypium spp.sequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU2577HAU2577Gossypium spp.marker_locus
HAU2577HAU2577-73.044Gossypium spp.marker_locus


Sequence
>HAU2577 ID=HAU2577|Name=HAU2577|organism=Gossypium spp.|type=genetic_marker|length=350bp
GTCCAGCTAGCAACCCTGCAAAGTTCATAATTACCAAAACAATGAAATTA
CAAATATATATTAAATATTATTTGTGACATGGGAAATATAACAAGTGATT
AATTACCATCCCCTGTAATCCTTGGGTTCCCTGTTAGCCTTAAGCATTGC
CTTCAGTTCATCGGATGTTAAGGCATCCGAATGAGTGAGAGCGAATTTGG
CGAAAATTTCTTCGAACTTCCACGACACAAACCTATCATACAAGTTCAAT
TTTAGATATGCATGAAATGATCATTTATTTATTTATTTATTTCCATTTAC
ATACCTTCCTTTACTATCATATACACCAAAGTCACTCCCATGCTTCGCCA