HAU2389

Marker Overview
NameHAU2389
Genbank IDES829766
TypeSSR
SpeciesGossypium spp.
Source TypeEST
Repeat Motif(CCGCCA)3
PCR ConditionAnnealing temperature: 57.0
Primer 1HAU2389_F: TTCCGTTCTCCCCACCCACT
Primer 2HAU2389_R: GGCGACGATACGAGGCTGAG
Product Length107
Publication[view all]
CommentPrimer data obtained in 2012
References
External references for this genetic_marker
DatabaseAccession
DB:genbankES834276
DB:genbankES799012
DB:genbankES838900
DB:genbankES829766
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr02N/AAt.02111.1HAU2389View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr02N/AAD_chr.0239.2HAU2389View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr02N/AAt.0280.25HAU2389-80.25View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU2389_FHAU2389_FGossypium spp.primer
HAU2389_RHAU2389_RGossypium spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU2389HAU2389Gossypium spp.marker_locus
HAU2389HAU2389-80.25Gossypium spp.marker_locus


Sequence
>HAU2389 ID=HAU2389|Name=HAU2389|organism=Gossypium spp.|type=genetic_marker|length=107bp
TTCCGTTCTCCCCACCCACTCCTCAGATCACTCTCCTCCCTTCCTCCGCC
ACCGCCACCGCCACGGGCACCAACACCACAACTCCTTCTCAGCCTCGTAT
CGTCGCC