HAU2200

Marker Overview
NameHAU2200
Genbank IDES841980
TypeSSR
SpeciesGossypium spp.
Source TypeEST
Repeat Motif(ATC)8
PCR ConditionAnnealing temperature: 55.1
Primer 1HAU2200_F: ACGCGGTGGGCGAATGATTA
Primer 2HAU2200_R: AACGGGTAAATGTCTGCCCT
Product Length250
Publication[view all]
CommentPrimer data obtained in 2012
References
External references for this genetic_marker
DatabaseAccession
DB:genbankES844952
DB:genbankES818375
DB:genbankES815375
DB:genbankES828696
DB:genbankES841980
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr20N/AAD_chr.2058.79HAU2200View
2TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr20-2N/AAD_chr.2020.1HAU2200View
3CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr20N/ADt.10100.2HAU2200View
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr10N/AAD_chr.1034.1HAU2200View
5CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr10N/AAt.1046.87HAU2200-46.867View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU2200_FHAU2200_FGossypium spp.primer
HAU2200_RHAU2200_RGossypium spp.primer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.TTT-CSIL_ch20-2.p1-df12Gossypium hirsutumQTL
seed cotton weight per bollqBWT.TTT-CSIL_ch20-2.p1-nj14Gossypium hirsutumQTL
seed indexqSI.TTT-CSIL_ch20-2.p1-df12Gossypium hirsutumQTL
seed indexqSI.TTT-CSIL_ch20-2.p1-nj13Gossypium hirsutumQTL
seed indexqSI.TTT-CSIL_ch20-2.p1-nj14Gossypium hirsutumQTL
seed indexqSI.TTT-CSIL_ch20-2.p1-sy15Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU2200HAU2200Gossypium spp.marker_locus
HAU2200HAU2200-46.867Gossypium spp.marker_locus


Sequence
>HAU2200 ID=HAU2200|Name=HAU2200|organism=Gossypium spp.|type=genetic_marker|length=250bp
ACGCGGTGGGCGAATGATTAGGTCGTAATTGGAAGCTTCTTTTTTTTTTA
CTGTTCTTCTACTGTAAATGGAAAAATCTCCAAAATCCATCAGAGGAAAA
GTAAAGCTTTTTTTCCTTCTAATGGTAAAGCTTTTTTTCCTTCTAATGGT
GAAAAAGCAGAAAAAAAAATAAAGTAGATCATCATCATCATCATCATCAT
CATGATTTCTCTTAGAAAGTTGAAAATTTTAGGGCAGACATTTACCCGTT