HAU2138

Marker Overview
NameHAU2138
Genbank IDEV497149
TypeSSR
SpeciesGossypium spp.
Source TypeEST
Repeat Motif(GAA)7
PCR ConditionAnnealing temperature: 55.8
Primer 1HAU2138_F: TGGGAGTAGAAGGCACTTGGA
Primer 2HAU2138_R: ACGCCGGAGAGGACCTTCTT
Product Length150
Publication[view all]
CommentPrimer data obtained in 2012
References
External references for this genetic_marker
DatabaseAccession
DB:genbankEV486129
DB:genbankEV482077
DB:genbankEV491289
DB:genbankEV497149
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr01N/AAD_chr.0170.41HAU2138View
2(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr01-2N/AAD_chr.0151.6HAU2138View
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0164.6HAU2138View
4Yumian-1 x 7235, RIL (2015)Y7-RIL_chr15N/AAD_chr.1595.3HAU2138View
5DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr07-1N/AAD_chr.0785.43HAU2138View
6CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr01N/AAt.0161.7HAU2138View
7CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr01N/AAD_chr.01101.6HAU2138View
8CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.0154.03HAU2138-54.033View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU2138_FHAU2138_FGossypium spp.primer
HAU2138_RHAU2138_RGossypium spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU2138HAU2138Gossypium spp.marker_locus
HAU2138HAU2138-54.033Gossypium spp.marker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM017688.1chromosomeCM017688.1:104624134..104624287 -
CM017701.1chromosomeCM017701.1:57817168..57817318 -
CM017636.1chromosomeCM017636.1:114506669..114506819 -
CM017649.1chromosomeCM017649.1:59732900..59733050 -
CM017610.1chromosomeCM017610.1:107123231..107123381 -
CM017623.1chromosomeCM017623.1:59172855..59173005 +
A01chromosomeA01:108491401..108491554 -
D01chromosomeD01:59072372..59072522 +
Gbar_A01chromosomeGbar_A01:108533481..108533634 -
Gbar_D01chromosomeGbar_D01:58418966..58419116 +
scaffold20973supercontigscaffold20973:16123..16273 +
scaffold20973supercontigscaffold20973:17274..17424 +
scaffold2395supercontigscaffold2395:126484..126637 +
scaffold2395supercontigscaffold2395:125109..125259 +
Dt01chromosomeDt01:57556882..57557032 +
Dt01chromosomeDt01:57558033..57558183 +
A01chromosomeA01:105557447..105557600 -
D01chromosomeD01:57106301..57106451 +
A01chromosomeA01:108784972..108785122 -
D01chromosomeD01:59869826..59869976 +
A01chromosomeA01:111159622..111159772 -
D01chromosomeD01:60074482..60074632 +
Ghir_A01chromosomeGhir_A01:110489255..110489405 -
Ghir_D01chromosomeGhir_D01:58456729..58456879 +
A01chromosomeA01:92967481..92967631 -
D01chromosomeD01:56785996..56786146 +
At_chr8chromosomeAt_chr8:22372230..22372380 -
Dt_chr2chromosomeDt_chr2:9041754..9041904 -
CM016614.1chromosomeCM016614.1:128865094..128865247 -
D10_01chromosomeD10_01:5407970..5408120 +
Chr9chromosomeChr9:10575060..10575210 -
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:92122333..92122483 -
Chr2chromosomeChr2:42861887..42862037 +
KI_01chromosomeKI_01:34162099..34162252 -
D5_01chromosomeD5_01:51547783..51547933 -
CM018202.1chromosomeCM018202.1:106092010..106092163 -
CM018215.1chromosomeCM018215.1:58196348..58196498 +
A01chromosomeA01:96928878..96929028 -
D01chromosomeD01:59538276..59538426 +
Sequence
>HAU2138 ID=HAU2138|Name=HAU2138|organism=Gossypium spp.|type=genetic_marker|length=150bp
TGGGAGTAGAAGGCACTTGGAATACATCTCTGATTTGCTTAGCAGCGTGA
AGAAGAAGAAGAAGAAGAAGCAAATTCAAACTGTAGCTCTCAAAATCAGG
ATGGATTGTGAAGGTTGTGCTCGTAAGGTCAAGAAGGTCCTCTCCGGCGT