HAU1865

Marker Overview
NameHAU1865
Genbank IDDT567072
TypeSSR
SpeciesGossypium spp.
Source SequenceDT567072
Source TypeEST
Repeat Motif(TCT)7
PCR ConditionAnnealing temperature: 56.7
Primer 1HAU1865_F: ATGGCATTTTTAAGGTTGCT
Primer 2HAU1865_R: GTAAGAAGGTCAGGCAAGGA
Product Length287
Publication[view all]
CommentPrimer data obtained in 2012
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT567072
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1W10 x TM-1, F2:3 (2015)WT-F2:3_chr08N/AAD_chr.0861.5HAU1865View
2CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr08N/AAt.0830.4HAU1865View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr08N/AAD_chr.0827.6HAU1865View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr08N/AAt.0887.73HAU1865-87.733View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU1865_FHAU1865_FGossypium spp.primer
HAU1865_RHAU1865_RGossypium spp.primer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
micronaireqMIC.CY-RIL_ch08.swu08Gossypium hirsutumQTL
micronaireqMIC.CY-RIL_ch08.swu09Gossypium hirsutumQTL
micronaireqMIC.CY-RIL_ch08.swu12Gossypium hirsutumQTL
micronaireqMIC.CY-RIL.17_ch08.ez15Gossypium hirsutumQTL


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT567072DT567072Gossypium spp.sequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU1865HAU1865Gossypium spp.marker_locus
HAU1865HAU1865-87.733Gossypium spp.marker_locus


Sequence
>HAU1865 ID=HAU1865|Name=HAU1865|organism=Gossypium spp.|type=genetic_marker|length=287bp
ATGGCATTTTTAAGGTTGCTGACCCCTGCCACTGCCATAGCCGCTGCCTC
TGCCTCTGCTCTGCCTGCCGCCTTTGTTTTCTCTTCTTCTTCTTCTTCTT
CCTCCTCCTCTTCTCGCAATTCTTCTCATTTCCCCAACGCAAAAAGCCTC
CCTTTCCTCTCTTCACCACCCAATCGCTTAGGCCTTATAAGGAACTTCGC
GACCTCTCCCATTGCTCTTAACATGGATTCACCCTCATCTAATCACAACC
CATCTCAGGAAAATGGGTCCTTGCCTGACCTTCTTAC