HAU1172

Marker Overview
NameHAU1172
AliasTA28991_3635
Genbank IDN/A
TypeSSR
SpeciesGossypium spp.
Source TypeEST
Repeat Motif(CTT)6
PCR ConditionAnnealing temperature: 57.0
Primer 1HAU1172_F: TACCTTTGCCTCTCAACTCC
Primer 2HAU1172_R: AGGATGTCTACGTGGTCGTT
Product Length171
Publication[view all]
CommentPrimer data obtained in 2012
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr07N/AAD_chr.0785.06HAU1172View
2(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr16-2N/AAD_chr.1688.6HAU1172View
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr16N/AAD_chr.16108.1HAU1172View
4Yumian-1 x 7235, RIL (2015)Y7-RIL_chr16N/AAD_chr.1615HAU1172View
5CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr07N/AAt.0786.4HAU1172View
6CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr16N/AAD_chr.16170.5HAU1172View
7CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr16N/ADt.07119.47HAU1172-119.468View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU1172_FHAU1172_FGossypium spp.primer
HAU1172_RHAU1172_RGossypium spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU1172HAU1172Gossypium spp.marker_locus
HAU1172HAU1172-119.468Gossypium spp.marker_locus


Sequence
>HAU1172 ID=HAU1172|Name=HAU1172|organism=Gossypium spp.|type=genetic_marker|length=171bp
TACCTTTGCCTCTCAACTCCTCAACGCTATCTCCTTCTTCTTCTTCTTCT
TCACTATCTCTTTTTTAACTTAAACGATGGTGCAAAACCACCGCCGTGAA
GACCACGAGACAGGCGGTGAGAACAAGGAAAAAAGACCCAAGTTCTTTAT
CAACGACCACGTAGACATCCT