HAU1120

Marker Overview
NameHAU1120
AliasTA27061_3635
Genbank IDN/A
TypeSSR
SpeciesGossypium spp.
Source TypeEST
Repeat Motif(AT)9
PCR ConditionAnnealing temperature: 57.3
Primer 1HAU1120_F: GCCATAGGGAGCTGAACTAA
Primer 2HAU1120_R: ATGGAGCTCAAAATGTCACC
Product Length217
Publication[view all]
CommentPrimer data obtained in 2012
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr21-1N/AAD_chr.215.4HAU1120View
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr21N/AAD_chr.2186.6HAU1120View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr21N/AAD_chr.2153HAU1120View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr21N/ADt.1115.3HAU1120-15.299View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU1120_FHAU1120_FGossypium spp.primer
HAU1120_RHAU1120_RGossypium spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU1120HAU1120Gossypium spp.marker_locus
HAU1120HAU1120-15.299Gossypium spp.marker_locus


Sequence
>HAU1120 ID=HAU1120|Name=HAU1120|organism=Gossypium spp.|type=genetic_marker|length=217bp
GCCATAGGGAGCTGAACTAAAAACTCCCTGAGCGACCTGATCGGCTGTCA
TTGAAATTCTCCAGGCTTGGAAGCATATCCAGAAACAGGATATATATATA
TATATAAGCAAGTTTTTTGTGTGGAATGTAGTTATTGGTTTTTTTGTTTT
AGAGCTTCCAAAATTGAGAAAGCTCTTTTTTCATGTATCCTAGAGAAGGT
GACATTTTGAGCTCCAT