HAU1044

Marker Overview
NameHAU1044
AliasTA24686_3635
Genbank IDN/A
TypeSSR
SpeciesGossypium spp.
Source TypeEST
Repeat Motif(CGG)5
PCR ConditionAnnealing temperature: 57.0
Primer 1HAU1044_F: TGGTCTGTATCCGTTCATTG
Primer 2HAU1044_R: TTTTCGTATTTGTGGTGGTG
Product Length193
Publication[view all]
CommentPrimer data obtained in 2012
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr01-1N/AAD_chr.0114.3HAU1044View
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr15N/AAD_chr.151.9HAU1044View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr15N/AAD_chr.1533.5HAU1044View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.015.64HAU1044-5.637View
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber lengthqFL.YCY7-4WC_chr01-1.bb07Gossypium hirsutumQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU1044_FHAU1044_FGossypium spp.primer
HAU1044_RHAU1044_RGossypium spp.primer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.CY-RIL.17_ch15.kl14Gossypium hirsutumQTL
fiber strengthqFS.CY-RIL.17_ch15.kl14Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU1044HAU1044Gossypium spp.marker_locus
HAU1044HAU1044-5.637Gossypium spp.marker_locus


Sequence
>HAU1044 ID=HAU1044|Name=HAU1044|organism=Gossypium spp.|type=genetic_marker|length=193bp
TGGTCTGTATCCGTTCATTGGGACTAACAGGGAAACGTTAGAGATCATTA
TCGGCGGCGGCGGCGGTGAAGCTCCTGCTCCGTCGCCTGAAGATTGTCCT
CCTCCGCCACCTGAACCTGAATGTCCACCTCCAGCATCTCCACCACCACC
ACCACCACCACCACCACCACCACCACCACCACAAATACGAAAA