HAU0367

Marker Overview
NameHAU0367
Genbank IDBF272130
TypeSSR
SpeciesGossypium spp.
Source SequenceBF272130
Source TypeEST
Repeat Motif(TTG)6
PCR ConditionAnnealing temperature: 57.0
Primer 1HAU0367_F: TGAAGCCGAAAGTAACAACA
Primer 2HAU0367_R: GTGAACCTGAAACCAAAACC
Product Length286
Publication[view all]
CommentPrimer data obtained in 2012
References
External references for this genetic_marker
DatabaseAccession
DB:genbankBF272130
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
10-153 x sGK9708, RIL (2016)0s-RIL_chr18-1N/AAD_chr.1840.4HAU367View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU0367_FHAU0367_FGossypium spp.primer
HAU0367_RHAU0367_RGossypium spp.primer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BF272130BF272130Gossypium spp.sequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU367HAU367Gossypium spp.marker_locus


Sequence
>HAU0367 ID=HAU0367|Name=HAU0367|organism=Gossypium spp.|type=genetic_marker|length=286bp
TGAAGCCGAAAGTAACAACATGGAACACGGGAAGAAGAAGTGCTTATGCG
GATCGCTGAAATGCAGAGGCTACTTTTATTGAGGTTACAAAAAAGCTGTA
TCATGTAGACAAGCAAAGACTTTTTGGGTTTTTGGATATCTAATCATGTA
ATTCTATATGCTTTTTCATCTCTAGTTTTTGTAGCTCAGAACTGACAACA
TATGTGAACCAAAGCATGATGATGTTTTTTTGTTGTTGTTGTTGTTCTCT
GGTTTGTAGGAAGTTAGGTTTTGGTTTCAGGTTCAC