HAU0270

Marker Overview
NameHAU0270
Genbank IDN/A
TypeSSR
SpeciesGossypium spp.
Source TypeEST
Repeat Motif(TTTA)4
PCR ConditionAnnealing temperature: 56.9
Primer 1HAU0270_F: GAAGACCAAAAAGGCAATGT
Primer 2HAU0270_R: TGCCTTTCGTTCATCACTAA
Product Length127
Publication[view all]
CommentPrimer data obtained in 2012
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr23-2N/AAD_chr.23123.3HAU0270View
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr23N/AAD_chr.2366.6HAU0270View
3DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr09-1N/AAD_chr.09103.6HAU0270View
4DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr23N/AAD_chr.23103.6HAU0270View
5DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr09N/AAD_chr.0950.2HAU0270View
6DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr23N/AAD_chr.2350.2HAU0270View
7CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr23N/AAD_chr.2325HAU0270View
8CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr23N/ADt.09163.87HAU0270-163.868View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU0270_FHAU0270_FGossypium spp.primer
HAU0270_RHAU0270_RGossypium spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU0270HAU0270Gossypium spp.marker_locus
HAU0270HAU0270-163.868Gossypium spp.marker_locus


Sequence
>HAU0270 ID=HAU0270|Name=HAU0270|organism=Gossypium spp.|type=genetic_marker|length=127bp
GAAGACCAAAAAGGCAATGTTGGAGGAGATTTGCTTCTTTTTTATTTATC
TATTTACCTATCTTTTCTTTTTTTAAATGTTCATGGGGTCAGCTGGCAAG
CCTTTTTTTAGTGATGAACGAAAGGCA