TMB2377

Marker Overview
NameTMB2377
AliasTMB200-3-P5
Genbank IDBV679752
TypeSSR
SpeciesGossypium hirsutum
GermplasmTM-1
Source SequenceBV679752.1
Source Typegenomic
Repeat Motif(TTA)18
PCR ConditionAnnealing temperature: 55
Primer 1TMB2377_F: TAGTCCCTTACTTTCAATATTTTATA
Primer 2TMB2377_R: TGTTTTGGTGTAGTGATATAAACG
Product Length240
ContactYu, John Z. (Zhi-Hong)
CommentPrimer data obtained in 2005-10
References
External references for this genetic_marker
DatabaseAccession
DB:genbankBV679752
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr25N/AAD_chr.2541TMB2377View
2TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c25N/AAD_chr.2598.17TMB2377View
3Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr25N/AAD_chr.2599.27TMB2377View
4DH962 x Jinmian-6, F2 (2009)DJ-F2_chr25.1N/AAD_chr.25130.2TMB2377View
5DH962 x Jinmian-6, F2 (2009)DJ-F2_chr25/LG4N/AAD_chr.25130.2TMB2377View
6DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr25-1N/AAD_chr.25118.83TMB2377View
7TM-1 x 3-79, RIL (2014)T3-RIL.14_chr25N/AAD_chr.2593TMB2377View
80-153 x sGK9708, RIL (2015)0s-RIL.15_chr25N/AAD_chr.2581.28TMB2377View
90-153 x sGK9708, RIL (2016)0s-RIL_chr25-1N/AAD_chr.2592.9TMB2377View
10DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr25-1N/AAD_chr.25-10TMB2377View
11CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr25N/ADt.0675.6TMB2377View
120-153 x sGK9708, RIL (2017)0s-RIL.17_chr25N/AAD_chr.2542.27TMB2377View
13TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.25N/AAD_chr.2592.97TMB2377-92.965View
Contact
NameDetails
Yu, John Z. (Zhi-Hong)
Description:Cotton molecular genetics and genomics including integrative genome mapping and QTL identification from the Gossypium germplasm.
First name:John
Last name:Yu
Title:Research Geneticist
Institution:USDA-ARS
Address:2765 F&B Road, College Station, Texas 77845
Country:United States
Email:zyu@qutun.tamu.edu
Phone:1-979-260-9237
Fax:1-979-260-9333
Keywords:Cotton Molecular Genetics
Last update:6-Sep-2007
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TMB2377_FTMB2377_FGossypium hirsutumprimer
TMB2377_RTMB2377_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TMB2377TMB2377Gossypium hirsutummarker_locus
TMB2377TMB2377-92.965Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BV679752.1BV679752.1Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
TM-1TBD
Sequence
>TMB2377 ID=TMB2377|Name=TMB2377|organism=Gossypium hirsutum|type=genetic_marker|length=240bp
TAGTCCCTTACTTTCAATATTTTATATTTTATTTTCCTTTTTATAAATTT
ATTCATGTATTTATTCATTTATCTTTTTATTTCTTTTTATTTTTGTGTTA
TACTTTTTTTCTTACCATTATTATTATTATTATTATTATTATTATTATTA
TTATTATTATTATTATTATTATTTCATTTATTTACATATTTTACTCCAAA
TTGTACCTTTAAATTTCGTTTATATCACTACACCAAAACA