TMB1561

Marker Overview
NameTMB1561
AliasNBRI_GE69851
TMH B71-i4
TMB1561=RC(NBRI_GE69851)
Genbank IDBV679600
TypeSSR
SpeciesGossypium hirsutum
GermplasmTM-1
Source SequenceBV679600.1
Source Typegenomic
Repeat Motif(GA)6+ (GAA)5; (GA)6+(GAA)5
PCR ConditionAnnealing temperature: 55
Primer 1TMB1561_F: AAATGGCTGGTCTTCGCTTA
Primer 2TMB1561_R: TGTGCTGCTTCTCCATGACT
Product Length250
ContactYu, John Z. (Zhi-Hong)
CommentPrimer data obtained in 2005-10
References
External references for this genetic_marker
DatabaseAccession
DB:genbankBV679600
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c07N/AAD_chr.0780.58TMB1561View
2TM-1 x 3-79, RIL (2014)T3-RIL.14_chr07N/AAD_chr.0758.6TMB1561View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr16N/AAD_chr.16123.8TMB1561View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr16N/ADt.0794.45TMB1561-94.447View
5TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.07N/AAD_chr.0758.6TMB1561-58.603View
Contact
NameDetails
Yu, John Z. (Zhi-Hong)
Description:Cotton molecular genetics and genomics including integrative genome mapping and QTL identification from the Gossypium germplasm.
First name:John
Last name:Yu
Title:Research Geneticist
Institution:USDA-ARS
Address:2765 F&B Road, College Station, Texas 77845
Country:United States
Email:zyu@qutun.tamu.edu
Phone:1-979-260-9237
Fax:1-979-260-9333
Keywords:Cotton Molecular Genetics
Last update:6-Sep-2007
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TMB1561_FTMB1561_FGossypium hirsutumprimer
TMB1561_RTMB1561_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TMB1561TMB1561Gossypium hirsutummarker_locus
TMB1561TMB1561-94.447Gossypium hirsutummarker_locus
TMB1561TMB1561-58.603Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BV679600.1BV679600.1Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
TM-1TBD
Sequence
>TMB1561 ID=TMB1561|Name=TMB1561|organism=Gossypium hirsutum|type=genetic_marker|length=250bp
AAATGGCTGGTCTTCGCTTACCCTTTCTCCCTAATATCTCTTTTAATAAT
TTTTCTTTCTGGGCCACCCCTTAAAGCCATTGCTCTTTTTGGGAATTATT
ATTACTATTATATATAACTCTACTACTGTAATTACTCCTTTCTTGTTGAA
AGCTTGAAAAAGCTATATAACTACTCCTCTCCCCCTTCTCTCTCTCTCTT
TCTTCTTCTTCTTCTTTTTTTTTTCCTTTTAGTCATGGAGAAGCAGCACA