TMB1497

Marker Overview
NameTMB1497
AliasTMH B6-F5
Genbank IDBV679589
TypeSSR
SpeciesGossypium hirsutum
GermplasmTM-1
Source SequenceBV679589.1
Source Typegenomic
Repeat Motif(GA)10
PCR ConditionAnnealing temperature: 55
Primer 1TMB1497_F: ACCTCAGCTTTACATGCAAAG
Primer 2TMB1497_R: CATTTCTATACGAACACAGAGC
Product Length213
PolymorphismP_ TMB1497
ContactYu, John Z. (Zhi-Hong)
CommentPrimer data obtained in 2005-10
References
External references for this genetic_marker
DatabaseAccession
DB:genbankBV679589
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
10-153 x sGK9708, RIL (2016)0s-RIL_chr02-3N/AAD_chr.020TMB1497View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr02N/AAD_chr.0210.4TMB1497View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr02N/AAt.02104.67TMB1497-104.671View
Contact
NameDetails
Yu, John Z. (Zhi-Hong)
Description:Cotton molecular genetics and genomics including integrative genome mapping and QTL identification from the Gossypium germplasm.
First name:John
Last name:Yu
Title:Research Geneticist
Institution:USDA-ARS
Address:2765 F&B Road, College Station, Texas 77845
Country:United States
Email:zyu@qutun.tamu.edu
Phone:1-979-260-9237
Fax:1-979-260-9333
Keywords:Cotton Molecular Genetics
Last update:6-Sep-2007
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TMB1497_FTMB1497_FGossypium hirsutumprimer
TMB1497_RTMB1497_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BV679589.1BV679589.1Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TMB1497TMB1497Gossypium hirsutummarker_locus
TMB1497TMB1497-104.671Gossypium hirsutummarker_locus


Germplasm
Stock NameType
TM-1TBD
Sequence
>TMB1497 ID=TMB1497|Name=TMB1497|organism=Gossypium hirsutum|type=genetic_marker|length=213bp
ACCTCAGCTTTACATGCAAAGAAAAAAGAGAGAGAGAGAGAGAGAGAAAG
GGTGCAATCCTCTAAGCGAGTAATGGTGAAAATGGCGTGGGCAGTGTTCT
TGTACGTCGGGCAATTATTAACTGGGCCATCGTAAACTGTTTCAGAACTA
AATCCAATTAATACCAAAAGGAAAACATTTTTTCTCTTTAAGCTCTGTGT
TCGTATAGAAATG