TMB0382

Marker Overview
NameTMB0382
AliasTMO06
Genbank IDBV679883
TypeSSR
SpeciesGossypium hirsutum
GermplasmTM-1
Source Sequencereverse_complement_BV679883.1
Source Typegenomic
Repeat Motif(GAA)8
PCR ConditionAnnealing temperature: 55
Primer 1TMB0382_F: TTGGTTGAGTGTTGGGGAAT
Primer 2TMB0382_R: GCATGAGCCTTCCTTCCATA
Product Length183
PolymorphismP_ TMB0382
ContactYu, John Z. (Zhi-Hong)
CommentPrimer data obtained in 2005-10
References
External references for this genetic_marker
DatabaseAccession
DB:genbankBV679883
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr23N/AAD_chr.2383.5TM006View
2Deltapine-61 x Texas-701, F2 (2007)Deltapine-61 x Texas-701, F2 (2007).DT-F2_chr.23N/AAD_chr.236TMB0382-184View
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr23N/AAD_chr.23141tmb0382View
4TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c23N/AAD_chr.2364.45tmb0382View
5(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr23-2N/AAD_chr.23100.1tmb0382View
6DH962 x Jinmian-6, F2 (2009)DJ-F2_chr23.1N/AAD_chr.2380.3tmb0382View
7DH962 x Jinmian-6, F2 (2009)DJ-F2_chr23/LG11N/AAD_chr.2380.3tmb0382View
8DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr09-1N/AAD_chr.0982.23tmb0382View
9DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr23N/AAD_chr.2382.23tmb0382View
10TM-1 x 3-79, RIL (2014)T3-RIL.14_chr23N/AAD_chr.2379.4tmb0382View
11DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr09N/AAD_chr.0936.3tmb0382View
12DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr23N/AAD_chr.2336.3tmb0382View
13CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr23N/AAD_chr.2346.1tmb0382View
14TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr23N/AAD_chr.23109.7TMO06-190View
15Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr23N/AAD_chr.237.9TMO06-190View
16TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr23/D9N/AAD_chr.23109.24TMO06-190View
17Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg12/chr23N/AAD_chr.2352.9TMHO06View
18HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr23-1N/AAD_chr.2314.7TMO06View
19TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr23N/AAD_chr.2333TMO06View
20CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr23N/ADt.09140.44TMB0382-140.441View
21TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.23N/AAD_chr.2379.36TMB0382-79.357View
Contact
NameDetails
Yu, John Z. (Zhi-Hong)
Description:Cotton molecular genetics and genomics including integrative genome mapping and QTL identification from the Gossypium germplasm.
First name:John
Last name:Yu
Title:Research Geneticist
Institution:USDA-ARS
Address:2765 F&B Road, College Station, Texas 77845
Country:United States
Email:zyu@qutun.tamu.edu
Phone:1-979-260-9237
Fax:1-979-260-9333
Keywords:Cotton Molecular Genetics
Last update:6-Sep-2007
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TMB0382_FTMB0382_FGossypium hirsutumprimer
TMB0382_RTMB0382_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.DJiM-RIL_ch09.j11.4Gossypium hirsutumQTL
seed cotton weight per bollqBWT.DJiM-RIL_ch23.j11.4Gossypium hirsutumQTL
lint yieldqLY.DJiM-RIL_ch09.j11.4Gossypium hirsutumQTL
lint yieldqLY.DJiM-RIL_ch23.j11.4Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TM006TM006Gossypium hirsutummarker_locus
TMB0382-184TMB0382-184Gossypium hirsutummarker_locus
tmb0382tmb0382Gossypium hirsutummarker_locus
TMO06-190TMO06-190Gossypium hirsutummarker_locus
TMHO06TMHO06Gossypium hirsutummarker_locus
TMO06TMO06Gossypium hirsutummarker_locus
TMB0382TMB0382-140.441Gossypium hirsutummarker_locus
TMB0382TMB0382-79.357Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
reverse_complement_BV679883.1reverse_complement_BV679883.1Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
TM-1TBD
Sequence
>TMB0382 ID=TMB0382|Name=TMB0382|organism=Gossypium hirsutum|type=genetic_marker|length=183bp
TTGGTTGAGTGTTGGGGAATGTTTGACGGTGATATGATATTTTATCTTGT
TTTTCTTTTTTTTTGGTAAATTACACTAATAAGAGAAGAAGAAGAAGAAG
AAGAAGAAGCAGCAGCAGCAGCAGTAGAAGAGACAATTATCAAGTACGAC
CATTGGTTTATTTTATGGAAGGAAGGCTCATGC