NAU0992

Marker Overview
NameNAU0992
AliasNAU992
Genbank IDBQ406705
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(AT)13
PCR ConditionAnnealing temperature: 57
Primer 1NAU992_F: AGAAAAGCGCTGCTGATAGT
Primer 2NAU992_R: GGGTGGCTTGACAAGTCTAT
Product Length223
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankBQ406705
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
17235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_A10N/AAD_chr.100NAU992View
27235 x TM-1, F2:3 (2005)7T-F2:3_chr10N/AAD_chr.1026.9NAU992View
3HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr10N/AAD_chr.102.9NAU992View
4(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr19-2N/AAD_chr.1924.3NAU0992View
5Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.0544.1NAU0992View
6CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr05N/AAD_chr.05124.5NAU0992View
70-153 x sGK9708, RIL (2016)0s-RIL_chr19-2N/AAD_chr.1926.3NAU0992aView
80-153 x sGK9708, RIL (2016)0s-RIL_chr19-2N/AAD_chr.1927.7NAU0992bView
9CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr05N/AAt.0517.59NAU0992-17.594View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU992_FNAU992_FGossypium arboreumprimer
NAU992_RNAU992_RGossypium arboreumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
boll sizeqBS.7T-ch10.e2Gossypium hirsutumQTL
fiber strengthqFS.0s-RIL_ch19-2.ay08Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU992NAU992Gossypium arboreummarker_locus
NAU0992NAU0992Gossypium arboreummarker_locus
NAU0992aNAU0992aGossypium arboreummarker_locus
NAU0992bNAU0992bGossypium arboreummarker_locus
NAU0992NAU0992-17.594Gossypium arboreummarker_locus


Germplasm
Stock NameType
AKA 8400TBD
AKA 8400TBD
Sequence
>NAU0992 ID=NAU0992|Name=NAU0992|organism=Gossypium arboreum|type=genetic_marker|length=223bp
AGAAAAGCGCTGCTGATAGTGTTCCATTGGAGCACATCACCCGTATTTTC
CCCATTCTTGGTTAAGCCTCTAGCCGGGATGAACAATTTTTTGGAGTTAT
TTGTGCCATGTTTTCGATGACATTGNGACCATTCTCTNTGTTTTTTTGTT
TTGGATATATATATATATATATATATATATAGCTGAGAACAAGCTATTTT
AGGATAGACTTGTCAAGCCACCC