NAU0941

Marker Overview
NameNAU0941
AliasNAU941
Genbank IDBQ409473
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(ATCGTC)3
PCR ConditionAnnealing temperature: 57
Primer 1NAU941_F: CACTCTGTTCATCAGCCTCA
Primer 2NAU941_R: AGACTGTGGGGGAATCATTA
Product Length199
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankBQ409473
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr03-2N/AAD_chr.030NAU0941View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr17N/AAD_chr.1775.9NAU0941View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr17N/ADt.0379.72NAU0941-79.722View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU941_FNAU941_FGossypium arboreumprimer
NAU941_RNAU941_RGossypium arboreumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
micronaireqMIC.CY-RIL.17_ch17.kl15Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU0941NAU0941Gossypium arboreummarker_locus
NAU0941NAU0941-79.722Gossypium arboreummarker_locus


Germplasm
Stock NameType
AKA 8400TBD
AKA 8400TBD
Sequence
>NAU0941 ID=NAU0941|Name=NAU0941|organism=Gossypium arboreum|type=genetic_marker|length=199bp
CACTCTGTTCATCAGCCTCAAACTTGAAGATCACTTCTTCTTGATGTGGG
AAAAACTTTGCTCTCTGATCTGTTCCTACTCAACATTCTCTTCAAAGAAC
AACCAATGGAAGACGAAGCTGAAAGATCGTCATCGTCATCGTCAATGGGT
GCCGCAATTTGATGATGACGACCAGAATCTAATGATTCCCCCACAGTCT