NAU0751

Marker Overview
NameNAU0751
AliasNAU1401
NAU751
NAU0751=NAU1401
Genbank IDBQ415304
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(AT)10
PCR ConditionAnnealing temperature: 57
Primer 1NAU751_F: AATGCCACGGAGTACAATTT
Primer 2NAU751_R: TGCAAGAGTGGAAGTTGAAA
Product Length155
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankBQ415304
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr16N/AAD_chr.16130NAU751View
2H16 x T586, F2sel (2009)H16T586-F2sel_chr16N/AAD_chr.1627.5NAU751View
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c16N/AAD_chr.1683.11NAU0751View
4Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch16N/AAD_chr.1637.77NAU0751View
5AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr16N/AAD_chr.1688NAU0751View
6TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr16N/AAD_chr.1662.3NAU751-400View
7TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.1660.89NAU751-400View
8H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.1661NAU751-400View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU751_FNAU751_FGossypium arboreumprimer
NAU751_RNAU751_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU751NAU751Gossypium arboreummarker_locus
NAU0751NAU0751Gossypium arboreummarker_locus
NAU751-400NAU751-400Gossypium arboreummarker_locus


Germplasm
Stock NameType
AKA 8400TBD
AKA 8400TBD
Sequence
>NAU0751 ID=NAU0751|Name=NAU0751|organism=Gossypium arboreum|type=genetic_marker|length=155bp
AATGCCACGGAGTACAATTTGCAAACGCTCGGTAATGGCTACCGACATAG
ATTTAAATGTAACAGAAAACATATATATATATATATATATGTGTGTGTGT
GTACAAGTTTATGCCTCTCTCTCTCTCTGTCTAATTTTCAACTTCCACTC
TTGCA