NAU5411

Marker Overview
NameNAU5411
Genbank IDDR457242
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Xuzhou 142
Source SequenceDR457242.1
Source TypeEST
Repeat Motif(gaa)7
PCR ConditionAnnealing temperature: 57
Primer 1NAU5411_F: GAGTAGAAGGCACCTTGGAA
Primer 2NAU5411_R: AGTCCACGTCCACAGACTTT
Restriction EnzymeEcoRI; XhoI
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDR457242
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr01N/AAD_chr.0178.32NAU5411View
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c01N/AAD_chr.0126.48NAU5411View
3Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch01N/AAD_chr.0132.3NAU5411View
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr01N/AAD_chr.0123NAU5411View
5Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0165.7NAU5411View
6Prema x 86-1, RIL (2015)P8-RIL_chr01.3N/AAD_chr.0188.18NAU5411View
7Yumian-1 x 7235, RIL (2015)Y7-RIL_chr15N/AAD_chr.1595.8NAU5411View
8W10 x TM-1, F2:3 (2015)WT-F2:3_chr01-1N/AAD_chr.0138.6NAU5411View
9SG 747 x Giza 75, BIL (2013)SG-BIL_chr01-1N/AAD_chr.0154.6NAU5411View
10TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr01N/AAD_chr.0179.4NAU5411-320View
11TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr01/A1N/AAD_chr.0182.44NAU5411-320View
12CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr01N/AAD_chr.01102.2NAU5411aView
13CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr15N/AAD_chr.15104.2NAU5411bView
14CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.0154.03NAU5411-54.033View
15CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.0190.41NAU5411-90.409View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU5411_FNAU5411_FGossypium hirsutumprimer
NAU5411_RNAU5411_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU5411NAU5411Gossypium hirsutummarker_locus
NAU5411-320NAU5411-320Gossypium hirsutummarker_locus
NAU5411aNAU5411aGossypium hirsutummarker_locus
NAU5411bNAU5411bGossypium hirsutummarker_locus
NAU5411NAU5411-54.033Gossypium hirsutummarker_locus
NAU5411NAU5411-90.409Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DR457242.1DR457242.1Gossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM017688.1chromosomeCM017688.1:104624034..104624284 -
CM017692.1chromosomeCM017692.1:22628090..22628370 -
CM017701.1chromosomeCM017701.1:57817069..57817315 -
CM017705.1chromosomeCM017705.1:20832744..20833021 -
CM017636.1chromosomeCM017636.1:114506569..114506816 -
CM017640.1chromosomeCM017640.1:23233333..23233613 -
CM017649.1chromosomeCM017649.1:59732801..59733047 -
CM017653.1chromosomeCM017653.1:21167742..21168019 -
CM017610.1chromosomeCM017610.1:107123131..107123378 -
CM017614.1chromosomeCM017614.1:22888560..22888840 -
CM017627.1chromosomeCM017627.1:20749223..20749500 -
CM017623.1chromosomeCM017623.1:59172858..59173104 +
A01chromosomeA01:108491301..108491551 -
A05chromosomeA05:23081184..23081464 -
D05chromosomeD05:20876907..20877184 -
D01chromosomeD01:59072375..59072621 +
Gbar_A01chromosomeGbar_A01:108533381..108533631 -
Gbar_A05chromosomeGbar_A05:22395299..22395579 -
Gbar_D05chromosomeGbar_D05:20876651..20876928 -
Gbar_D01chromosomeGbar_D01:58418969..58419215 +
scaffold9246supercontigscaffold9246:75472..75749 -
scaffold9246supercontigscaffold9246:76789..77069 -
scaffold20973supercontigscaffold20973:16126..16372 +
scaffold20973supercontigscaffold20973:17277..17523 +
scaffold2395supercontigscaffold2395:126487..126737 +
scaffold2395supercontigscaffold2395:125112..125359 +
At05chromosomeAt05:18282063..18282340 -
At05chromosomeAt05:18283380..18283660 -
Dt01chromosomeDt01:57556885..57557131 +
Dt01chromosomeDt01:57558036..57558282 +
A01chromosomeA01:105557347..105557597 -
A05chromosomeA05:23468937..23469217 -
D05chromosomeD05:20784417..20784683 -
D01chromosomeD01:57106304..57106550 +
A01chromosomeA01:108784872..108785119 -
A05chromosomeA05:23324550..23324830 -
D05chromosomeD05:20903100..20903366 -
D01chromosomeD01:59869829..59870075 +
A01chromosomeA01:111159522..111159769 -
A05chromosomeA05:22614924..22615204 -
D05chromosomeD05:20569003..20569269 -
D01chromosomeD01:60074485..60074731 +
Ghir_A01chromosomeGhir_A01:110489155..110489402 -
Ghir_A05chromosomeGhir_A05:23269679..23269959 -
Ghir_D05chromosomeGhir_D05:21049726..21049992 -
Ghir_D01chromosomeGhir_D01:58456732..58456978 +
A01chromosomeA01:92967381..92967628 -
A05chromosomeA05:21118363..21118643 -
D05chromosomeD05:20922577..20922843 -
D01chromosomeD01:56785999..56786245 +
At_chr8chromosomeAt_chr8:22372130..22372377 -
Dt_chr2chromosomeDt_chr2:9041655..9041901 -
Dt_chr9chromosomeDt_chr9:47223197..47223463 +
CM016614.1chromosomeCM016614.1:128864994..128865244 -
CM016618.1chromosomeCM016618.1:88857830..88858107 +
D10_01chromosomeD10_01:5407973..5408219 +
D10_05chromosomeD10_05:41095456..41095733 +
Chr9chromosomeChr9:10574961..10575207 -
Chr9chromosomeChr9:24547740..24548017 +
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:92122233..92122480 -
Chr05_CRI-A2_v1.0.a1chromosomeChr05_CRI-A2_v1.0.a1:23385183..23385463 -
Chr10chromosomeChr10:23421860..23422140 -
Chr2chromosomeChr2:42861890..42862137 +
KI_01chromosomeKI_01:34161999..34162249 -
KI_05chromosomeKI_05:17215099..17215375 -
D5_01chromosomeD5_01:51547684..51547930 -
D5_05chromosomeD5_05:19295434..19295711 -
CM018202.1chromosomeCM018202.1:106091910..106092160 -
CM018206.1chromosomeCM018206.1:22720649..22720929 -
CM018219.1chromosomeCM018219.1:20513897..20514174 -
CM018215.1chromosomeCM018215.1:58196351..58196597 +
A01chromosomeA01:96928778..96929025 -
A05chromosomeA05:23643229..23643509 -
D05chromosomeD05:21746056..21746322 -
D01chromosomeD01:59538279..59538525 +
Germplasm
Stock NameType
Xuzhou 142cultivar
Xuzhou 142cultivar
Sequence
>NAU5411 ID=NAU5411|Name=NAU5411|organism=Gossypium hirsutum|type=genetic_marker|length=177bp
GAGTAGAAGGCACCTTGGAATACATCTCTGATTTGCTTAGCAGCGTGAAG
AAGAAGAAGAAGAAGAAGCAAATTCAAACTGTAGCTCTCAAAATCAGGAT
GGATTGTGAAGGTTGTGCTCGTAAGGTCAAGAAGGTCCTCTCCGGCGTAN
AGGGGGCAAAGTCTGTGGACGTGGACT