NAU4864

Marker Overview
NameNAU4864
AliasNAU2954
NAU2954=NAU4864
NAU4864=NAU2954
Genbank IDDT543858
TypeSSR
SpeciesGossypium hirsutum
GermplasmTM-1
TM-1
Source SequenceDT543858.1
Source TypeEST
Repeat Motif(gggagt)3
PCR ConditionAnnealing temperature: 57
Primer 1NAU4864_F: AAGGAAATGCTGCCAACTAC
Primer 2NAU4864_R: AGACTTGCTCTGGTCTGCTT
Restriction EnzymeEcoRI; NotI
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT543858
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr23-2N/AAD_chr.23109.2NAU4864View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr23N/AAD_chr.2352.4NAU4864View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr23N/ADt.09153.13NAU4864-153.132View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU4864_FNAU4864_FGossypium hirsutumprimer
NAU4864_RNAU4864_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT543858.1DT543858.1Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU4864NAU4864Gossypium hirsutummarker_locus
NAU4864NAU4864-153.132Gossypium hirsutummarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr06chromosomeNAU4864:1..689 .
Chr06:43511276..43511943 -
Chr6chromosomeNAU4864:1..689 .
Chr6:7548061..7548728 +
Germplasm
Stock NameType
TM-1TBD
TM-1TBD
Sequence
>NAU4864 ID=NAU4864|Name=NAU4864|organism=Gossypium hirsutum|type=genetic_marker|length=221bp
AAGGAAATGCTGCCAACTACAGTGTCAATGGAAGTGCCTCAGGTAGTAAC
CATGGAAGCAATGGGCCAAATGGAAGTAGCAATGCAGTCAATACTGTAGG
GACAAACATGGAAAGTGATAATGGAATAGCTGGGAAAAGTGGAAGTGGTG
ATGCGAGCGGGAGTGGGAGTGGGAGTGGAAGCGGCAGTGGTAGTGGGAGC
AAAGCAGACCAGAGCAAGTCT