NAU3675

Marker Overview
NameNAU3675
Genbank IDCO115945
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(ag)7
PCR ConditionAnnealing temperature: 57
Primer 1NAU3675_F: GGCTTTGCCTGTGAATCTAT
Primer 2NAU3675_R: AGGTTTGAGGCTGAGAGTGT
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO115945
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_lg11N/AAD_unknown15.3NAU3675View
2CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr08N/AAt.08102.4NAU3675View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr04N/AAD_chr.0441.1NAU3675View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr24N/ADt.080NAU3675View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3675_FNAU3675_FGossypium raimondiiprimer
NAU3675_RNAU3675_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU3675NAU3675Gossypium raimondiimarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr04chromosomeNAU3675:1..433 .
Chr04:1533596..1534562 -
scaffold229supercontigNAU3675:1..433 .
scaffold229:323869..324835 -