NAU3550

Marker Overview
NameNAU3550
Genbank IDCO111476
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(tgt)6
PCR ConditionAnnealing temperature: 57
Primer 1NAU3550_F: CCGATTTCTTCATTTGCTTT
Primer 2NAU3550_R: CAAATACCCACCTCAAAACC
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO111476
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr16N/AAD_chr.163NAU3550View
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr16N/AAD_chr.16141.91NAU3550View
3SG 747 x Giza 75, BIL (2013)SG-BIL_chr16N/AAD_chr.160NAU3550View
4TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr16N/AAD_chr.168NAU3550-275View
5TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.167.86NAU3550-275View
6H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.167.9NAU3550-275View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3550_FNAU3550_FGossypium raimondiiprimer
NAU3550_RNAU3550_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU3550NAU3550Gossypium raimondiimarker_locus
NAU3550-275NAU3550-275Gossypium raimondiimarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM017694.1chromosomeCM017694.1:1445850..1446061 -
CM017707.1chromosomeCM017707.1:1274267..1274472 -
CM017642.1chromosomeCM017642.1:1329760..1329971 -
CM017655.1chromosomeCM017655.1:1310825..1311036 -
CM017616.1chromosomeCM017616.1:1267406..1267617 -
CM017629.1chromosomeCM017629.1:160582..160793 -
A07chromosomeA07:1346912..1347123 -
D07chromosomeD07:1263320..1263525 -
Gbar_A07chromosomeGbar_A07:1421630..1421841 -
Gbar_D07chromosomeGbar_D07:1286305..1286510 -
scaffold514supercontigscaffold514:43787..43998 +
scaffold5365supercontigscaffold5365:24336..24541 +
A07chromosomeA07:1374253..1374464 -
D07chromosomeD07:1234850..1235061 -
A07chromosomeA07:1355307..1355518 -
D07chromosomeD07:1296480..1296691 -
A07chromosomeA07:1282197..1282408 -
D07chromosomeD07:1264876..1265087 -
Ghir_A07chromosomeGhir_A07:1350867..1351078 -
Ghir_D07chromosomeGhir_D07:1325598..1325809 -
A07chromosomeA07:1319584..1319795 -
scaffold4168_D07supercontigscaffold4168_D07:93898..94109 +
scaffold666.1supercontigscaffold666.1:427800..428011 +
CM016620.1chromosomeCM016620.1:114238568..114238779 +
D10_07chromosomeD10_07:52645533..52645750 +
Chr1chromosomeChr1:34535078..34535289 +
Chr07_CRI-A2_v1.0.a1chromosomeChr07_CRI-A2_v1.0.a1:1447564..1447775 -
Chr1chromosomeChr1:1526175..1526386 -
KI_07chromosomeKI_07:36307126..36307340 +
D5_07chromosomeD5_07:1169708..1169919 -
CM018208.1chromosomeCM018208.1:1560891..1561102 -
CM018221.1chromosomeCM018221.1:1140407..1140612 -
A07chromosomeA07:1363179..1363390 -
D07chromosomeD07:1309192..1309403 -
Chr01chromosomeNAU3550:1..613 .
Chr01:1152160..1152772 +
Chr1chromosomeNAU3550:1..613 .
Chr1:34535068..34535680 -
Sequence
>NAU3550 ID=NAU3550|Name=NAU3550|organism=Gossypium raimondii|type=genetic_marker|length=212bp
CCGATTTCTTCATTTGCTTTACGTTGTTGTTGTTGTTGTTGTGCTCGGGT
TTGGTTGAACCGGGTTCATCTGTTTCAGGGTTGTGAACCGTTCCTGTGTT
TAGTTTACCGGAGTCGGATCTGCAAAAGGAGGTCACTCGCTGTAACAACG
ACGGTGCTCGGGTTAGGGACGGTTCGACGTAAACTGGGTCCGGGTTTTGA
GGTGGGTATTTG