NAU3424

Marker Overview
NameNAU3424
Genbank IDCO105844
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(atc)8
PCR ConditionAnnealing temperature: 57
Primer 1NAU3424_F: GTCAGGAAAAGCTGAAAGGA
Primer 2NAU3424_R: AAGAGGGCATTTCCATGATA
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO105844
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr24N/AAD_chr.2472.78NAU3424bView
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr24N/AAD_chr.2478.18NAU3424cView
3Emian-22 x 3-79, BC1 (2015)E3-BC1-2015_chr24N/AAD_chr.2470.5NAU3424cView
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr16N/AAD_chr.161nau3424View
5Yumian-1 x T586, RIL (2006)YT-RIL_chr08-2N/AAD_chr.085.4nau3424View
6Yumian-1 x T586, RIL (2015)YT-RIL.15_chr08N/AAD_chr.0885.1nau3424View
7Yumian-1 x 7235, RIL (2015)Y7-RIL_chr24N/AAD_chr.2433.5nau3424View
8CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr08N/AAD_chr.0825.6nau3424View
9TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr16N/AAD_chr.160NAU3424-210View
10TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.160NAU3424-210View
11H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.160NAU3424-210View
12Yumian-1 x T586, RIL (2009)YT-RIL_chr08-1N/AAD_chr.0856.4NAU3424/190y(C16)View
13CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr08N/AAt.0880.92NAU3424-80.919View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3424_FNAU3424_FGossypium raimondiiprimer
NAU3424_RNAU3424_RGossypium raimondiiprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber uniformityqFU.CY-RIL_ch08.swu10Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU3424bNAU3424bGossypium raimondiimarker_locus
NAU3424cNAU3424cGossypium raimondiimarker_locus
nau3424nau3424Gossypium raimondiimarker_locus
NAU3424-210NAU3424-210Gossypium raimondiimarker_locus
NAU3424/190y(C16)NAU3424/190y(C16)Gossypium raimondiimarker_locus
NAU3424NAU3424-80.919Gossypium raimondiimarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr04chromosomeNAU3424:18..694 .
Chr04:50530800..50531475 -
Chr8chromosomeNAU3424:18..694 .
Chr8:59349927..59350602 +
Sequence
>NAU3424 ID=NAU3424|Name=NAU3424|organism=Gossypium raimondii|type=genetic_marker|length=200bp
GTCAGGAAAAGCTGAAAGGATCAGGGGATTTTCCCCAGCCTGCTGTAAAA
AAATTGTCACCTGTATCTGCTTTCTCTGTATCATCATCATCATCATCATC
ATCAAGGGGTTTATTCCTCCCTGTAATTCAAAAAAACCCCCCTGCCCTCA
CTTTATCATCAAACCCTTTCAACAAAACCTTATCATGGAAATGCCCTCTT