NAU3377

Marker Overview
NameNAU3377
Genbank IDCO104248
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(tacta)6
PCR ConditionAnnealing temperature: 57
Primer 1NAU3377_F: TGCAAGGAATCAAGTTCACA
Primer 2NAU3377_R: CTGATTGTACTTTGCGGGTA
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO104248
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1MGG-293-793, MAGIC (2018)MAGIC-19831_chr11N/AAD_chr.116NAU3377c-6View
2(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_A11-1N/AAD_chr.1138.7NAU3377View
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr11N/AAD_chr.11298NAU3377View
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr21N/AAD_chr.21259NAU3377View
5Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A11N/AA_chr.11282NAU3377View
6(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr11-4N/AAD_chr.110NAU3377View
7TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr21N/AAD_chr.210NAU3377View
8(86-1 x G. anomalum) x Su8289, BC2F1 (2015)8S-BC2F1_chr11N/AB_chr.11211.1NAU3377View
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr21N/ADt.1156.8NAU3377View
10CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr21N/AAD_chr.2130.8NAU3377View
11Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr11N/AAD_chr.11233.08NAU3377cView
12MGG-293-793, MAGIC (2018)MAGIC-19831_chr21N/AAD_chr.210NAU3377dView
13Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr21N/AAD_chr.2114.26NAU3377dView
14Emian-22 x 3-79, BC1 (2015)E3-BC1-2015_chr21N/AAD_chr.210NAU3377dView
15TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr11N/AAD_chr.11163.9NAU3377-175View
16TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr11/A11N/AAD_chr.11165.04NAU3377-175View
17TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr21N/AAD_chr.21182.1NAU3377-120View
18TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr21/D11N/AAD_chr.21174.59NAU3377-120View
19Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch10/A10N/AAD_chr.1025.9NAU3377bView
20CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr21N/ADt.112.61NAU3377-2.612View
21PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr11N/AAt.11245.2NAU3377b-245.2View
22PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr21N/ADt.11259.7NAU3377a-259.7View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3377_FNAU3377_FGossypium raimondiiprimer
NAU3377_RNAU3377_RGossypium raimondiiprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.PA-F2_ch11.pop17-jointGossypium hirsutum x mustelinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
short fiber contentqSFC.PA-F2_ch21.pop03-06Gossypium hirsutum x mustelinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU3377cNAU3377c-6Gossypium raimondiimarker_locus
NAU3377NAU3377Gossypium raimondiimarker_locus
NAU3377cNAU3377cGossypium raimondiimarker_locus
NAU3377dNAU3377dGossypium raimondiimarker_locus
NAU3377-175NAU3377-175Gossypium raimondiimarker_locus
NAU3377-120NAU3377-120Gossypium raimondiimarker_locus
NAU3377bNAU3377bGossypium raimondiimarker_locus
NAU3377NAU3377-2.612Gossypium raimondiimarker_locus
NAU3377bNAU3377b-245.2Gossypium raimondiimarker_locus
NAU3377aNAU3377a-259.7Gossypium raimondiimarker_locus


Sequence
>NAU3377 ID=NAU3377|Name=NAU3377|organism=Gossypium raimondii|type=genetic_marker|length=167bp
TGCAAGGAATCAAGTTCACACTACATTTATTTATTTATATGCTATGCTAT
GATATATCATACTATACTAAGCTTTACTATACTATACTATACTATACTAT
ACTATACTGTACTATACTATACACCCATCTCATATGAAATGTATAAATAC
CCGCAAAGTACAATCAG