NAU3325

Marker Overview
NameNAU3325
Genbank IDCO101724
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(at)12
PCR ConditionAnnealing temperature: 57
Primer 1NAU3325_F: AGGCCTTTTTCATGAATGC
Primer 2NAU3325_R: GACAGGCACAAAGTTTGATTT
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO101724
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr05N/AAD_chr.05118.9NAU3325View
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.05138NAU3325View
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr05N/AAD_chr.0565.3NAU3325View
4W10 x TM-1, F2:3 (2015)WT-F2:3_chr05-1N/AAD_chr.0576.1NAU3325View
5CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr05N/AAD_chr.0547.5NAU3325View
6TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr05N/AAD_chr.0590.3NAU3325-225View
7TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr05/A5N/AAD_chr.0577.13NAU3325-225View
8CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr05N/AAt.05111.44NAU3325-111.436View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3325_FNAU3325_FGossypium raimondiiprimer
NAU3325_RNAU3325_RGossypium raimondiiprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
embryogenic callus formationqECF.WT-F2:3_chr5-1Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU3325NAU3325Gossypium raimondiimarker_locus
NAU3325-225NAU3325-225Gossypium raimondiimarker_locus
NAU3325NAU3325-111.436Gossypium raimondiimarker_locus


Sequence
>NAU3325 ID=NAU3325|Name=NAU3325|organism=Gossypium raimondii|type=genetic_marker|length=220bp
AGGCCTTTTTCATGAATGCGTGAATTTCAAAAAAAAAAAAACCACCAAAA
TACCATATATATATATATATATATATATTTTTCTAAAACCTATACCCCCT
TAAATTTATTAAATCAAAAACAAAACCTTAAAAACAATTTAACTTTAAAA
AAAAAAAAAAAAACCCAAGTCGGGATTTTGTTAAAATTTCTCTTTGGAAA
AATCAAACTTTGTGCCTGTC