NAU3291

Marker Overview
NameNAU3291
Genbank IDCO100428
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(ag)14
PCR ConditionAnnealing temperature: 57
Primer 1NAU3291_F: GGTAGGGCTAAGGACAACAA
Primer 2NAU3291_R: AATATGTTGCAGGTGGAGGT
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO100428
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr26N/AAD_chr.26168nau3291View
2Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch26/D12-2N/AAD_chr.262.1nau3291View
3Yumian-1 x 7235, RIL (2015)Y7-RIL_chr26N/AAD_chr.2676.6nau3291View
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr26N/AAD_chr.2663.4nau3291View
5TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr26N/AAD_chr.2682.2NAU3291-290View
6TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr26/D12N/AAD_chr.2676.03NAU3291-290View
7CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr26N/ADt.12109.75NAU3291-109.754View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3291_FNAU3291_FGossypium raimondiiprimer
NAU3291_RNAU3291_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
nau3291nau3291Gossypium raimondiimarker_locus
NAU3291-290NAU3291-290Gossypium raimondiimarker_locus
NAU3291NAU3291-109.754Gossypium raimondiimarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr08chromosomeNAU3291:1..723 .
Chr08:46933421..46934143 -
scaffold353supercontigNAU3291:1..723 .
scaffold353:168903..169625 -
Sequence
>NAU3291 ID=NAU3291|Name=NAU3291|organism=Gossypium raimondii|type=genetic_marker|length=201bp
GGTAGGGCTAAGGACAACAAATATATATGAAGCTAAAAGAGAGAGAGAGA
GAGAGAGAGAGAGAGATCCTCTAATCTAACATTAACCGGGGTTCCTCATC
CCCGCAGCGATTCCATTTATAGTAATTAGCAAAGCATCTCTGAGTTTGTT
GTTTTCATCATCACGTCTAAGCCTCCTCAGAACCTCCACCTGCAACATAT
T