NAU3243

Marker Overview
NameNAU3243
Genbank IDCO098472
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(aggaga)4
PCR ConditionAnnealing temperature: 57
Primer 1NAU3243_F: AACAACAACCATCTGCGTAA
Primer 2NAU3243_R: GGCAGCTACAATGGATTTCT
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO098472
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr06N/AAD_chr.0650.73NAU3243aView
2Emian-22 x 3-79, BC1 (2015)E3-BC1-2015_chr06N/AAD_chr.0650.9NAU3243aView
3Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr25N/AAD_chr.25106.27NAU3243bView
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr06N/AAD_chr.0634nau3243View
50-153 x sGK9708, RIL (2015)0s-RIL.15_chr25N/AAD_chr.2580.6nau3243View
60-153 x sGK9708, RIL (2016)0s-RIL_chr25-1N/AAD_chr.2592.6nau3243View
7CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr06N/AAt.06112.2nau3243View
8CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr25N/ADt.0679nau3243View
9SG 747 x Giza 75, BIL (2013)SG-BIL_chr06N/AAD_chr.0637.6nau3243View
100-153 x sGK9708, RIL (2017)0s-RIL.17_chr25N/AAD_chr.2543.47nau3243View
11TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr06N/AAD_chr.0644.7NAU3243-600View
12TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr06N/AAD_chr.0671NAU3243-250View
13TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr06/A6N/AAD_chr.0685.83NAU3243-250View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3243_FNAU3243_FGossypium raimondiiprimer
NAU3243_RNAU3243_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU3243aNAU3243aGossypium raimondiimarker_locus
NAU3243bNAU3243bGossypium raimondiimarker_locus
nau3243nau3243Gossypium raimondiimarker_locus
NAU3243-600NAU3243-600Gossypium raimondiimarker_locus
NAU3243-250NAU3243-250Gossypium raimondiimarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr10chromosomeNAU3243:1..794 .
Chr10:4284343..4285137 -
scaffold213supercontigNAU3243:1..794 .
scaffold213:374820..375614 -
Sequence
>NAU3243 ID=NAU3243|Name=NAU3243|organism=Gossypium raimondii|type=genetic_marker|length=236bp
AACAACAACCATCTGCGTAAAAATTGGGTTGTGTTTGGGAAGAAGAGAAA
GAGAGGTATGAAGTAGAAGGAGAAGGAGAAGGAGAAGGAGAGGGAGAATA
AGAAGAAGGGGAAGGAGAAGGGGAAGGGGAAGAAGAGGAAGAGGAAGAAG
CACTTTTCATAAAAGGTTCGAGTGCTTCCATCAACTCTCCACCATATATA
TCTGAACTGCTACTACAGAAATCCATTGTAGCTGCC