NAU3052

Marker Overview
NameNAU3052
Genbank IDCO090909
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(ctt)6
PCR ConditionAnnealing temperature: 57
Primer 1NAU3052_F: CGCAGCCTTTTCCTTTTT
Primer 2NAU3052_R: ACAAGCAAGCGATTCATACA
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO090909
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A09N/AA_chr.0998.7NAU3052View
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr09N/AAD_chr.09182NAU3052View
3(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr23-2N/AAD_chr.23108.5NAU3052View
4TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr23N/AAD_chr.2330.6NAU3052View
5GX1135 x GX100-2, F2 (2013)GG-F2_chr09N/AAD_chr.0976.2NAU3052View
6GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr09N/AAD_chr.09131.4NAU3052View
7GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr09N/AAD_chr.09131.4NAU3052View
80-153 x sGK9708, RIL (2016)0s-RIL_chr23-1N/AAD_chr.23135.2NAU3052View
9SG 747 x Giza 75, BIL (2013)SG-BIL_chr09N/AAD_chr.0948.1NAU3052View
10CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr23N/AAD_chr.2344.7NAU3052View
11TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr09/A9N/AAD_chr.0980.7NAU3052-180View
12TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr09N/AAD_chr.0980.7NAU3052-180View
13CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr23N/ADt.09141.02NAU3052-141.015View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3052_FNAU3052_FGossypium raimondiiprimer
NAU3052_RNAU3052_RGossypium raimondiiprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
lint yieldqLY.SG-BIL_ch09.ay07Gossypium hirsutum x barbadenseQTL
micronaireqMIC.SG-BIL_ch09.wa07Gossypium hirsutum x barbadenseQTL
seed cotton yieldqSCY.SG-BIL_ch09.ay07Gossypium hirsutum x barbadenseQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU3052NAU3052Gossypium raimondiimarker_locus
NAU3052-180NAU3052-180Gossypium raimondiimarker_locus
NAU3052NAU3052-141.015Gossypium raimondiimarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr06chromosomeNAU3052:1..818 .
Chr06:41840933..41841751 -
Chr6chromosomeNAU3052:1..818 .
Chr6:34004143..34004961 +
Sequence
>NAU3052 ID=NAU3052|Name=NAU3052|organism=Gossypium raimondii|type=genetic_marker|length=182bp
CGCAGCCTTTTCCTTTTTCCTTCTTCTTCTTCTTCTTTTTCCTTTTTAAC
TTCTGTGGGTGTTGAAGAAGAAAGCTTTCAGCTTTAGGTGCCTGGTGATT
GTTACAACTCTGTTGTAGTCAGTTGTTTTACTGGGTATGTGTCTTTTTCC
TGTTCCAACACTTGTATGAATCGCTTGCTTGT