NAU2854

Marker Overview
NameNAU2854
Genbank IDCO082621
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(at)4aa(at)6
PCR ConditionAnnealing temperature: 57
Primer 1NAU2854_F: TCACATGGCTTTTCTCTTCA
Primer 2NAU2854_R: ACATGGAGACCGAAGATTGT
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO082621
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
10-153 x sGK9708, RIL (2016)0s-RIL_chr20-2N/AAD_chr.20161NAU2854View
2CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr20N/ADt.1049.1NAU2854View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2854_FNAU2854_FGossypium raimondiiprimer
NAU2854_RNAU2854_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2854NAU2854Gossypium raimondiimarker_locus