NAU2836

Marker Overview
NameNAU2836
Genbank IDCO081868
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(ttg)5
PCR ConditionAnnealing temperature: 57
Primer 1NAU2836_F: ATTGGAAGGGTATTGAGCTG
Primer 2NAU2836_R: TCCTTTCCCACTTCTGTTCT
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO081868
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr03N/AAD_chr.0314.51NAU2836View
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr17N/AAD_chr.179NAU2836View
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr03N/AAD_chr.036NAU2836View
4Yumian-1 x T586, RIL (2006)YT-RIL_chr17-3N/AAD_chr.1727NAU2836View
5(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr17-3N/AAD_chr.170NAU2836View
6T582 x Hai-7124, F2 (2010)T5H-F2_chr3N/AAD_chr.03123.7NAU2836View
7Yumian-1 x T586, RIL (2015)YT-RIL.15_chr17N/AAD_chr.17115.9NAU2836View
8Yumian-1 x 7235, RIL (2015)Y7-RIL_chr17N/AAD_chr.17101.6NAU2836View
90-153 x sGK9708, RIL (2016)0s-RIL_chr03-1N/AAD_chr.0315.7NAU2836View
10TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr03/A3N/AAD_chr.03121.11NAU2836-220View
11TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr03N/AAD_chr.03123.7NAU2836-220View
12TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr17N/AAD_chr.17125.1NAU2836-780View
13TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr17/D3N/AAD_chr.1785.62NAU2836-780View
14Yumian-1 x T586, RIL (2009)YT-RIL_chr03-4N/AAD_chr.0327NAU2836/205y(C3,C17)View
15PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr17-1N/ADt.030NAU2836aView
16PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr17-2N/ADt.030NAU2836bView
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2836_FNAU2836_FGossypium raimondiiprimer
NAU2836_RNAU2836_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2836NAU2836Gossypium raimondiimarker_locus
NAU2836-220NAU2836-220Gossypium raimondiimarker_locus
NAU2836-780NAU2836-780Gossypium raimondiimarker_locus
NAU2836/205y(C3,C17)NAU2836/205y(C3,C17)Gossypium raimondiimarker_locus
NAU2836aNAU2836aGossypium raimondiimarker_locus
NAU2836bNAU2836bGossypium raimondiimarker_locus


Sequence
>NAU2836 ID=NAU2836|Name=NAU2836|organism=Gossypium raimondii|type=genetic_marker|length=212bp
ATTGGAAGGGTATTGAGCTGCTTGAACAGCCATTAACAAACAGAAAGAAA
AAGAAAAAAAGCTTTAACAAAATTTCACAACTTCGAAGAAGATAAATGAA
AAATCAAAGTGAAGAACAAGGTGGTATAGCATAAACATAAACCCAAATCA
TTTTTAGTATCTGGTTCTTGATATATATATATATATAAGAGTAGAACAGA
AGTGGGAAAGGA