NAU2835

Marker Overview
NameNAU2835
Genbank IDCO081860
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(aat)10
PCR ConditionAnnealing temperature: 57
Primer 1NAU2835_F: GCCCGGAATTATCAGTTTTA
Primer 2NAU2835_R: ATGGCGATGATACGGTAAAC
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO081860
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
10-153 x sGK9708, RIL (2016)0s-RIL_chr04N/AAD_chr.04120.6NAU2835View
20-153 x sGK9708, RIL (2017)0s-RIL.17_chr22N/AAD_chr.220NAU2835View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2835_FNAU2835_FGossypium raimondiiprimer
NAU2835_RNAU2835_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2835NAU2835Gossypium raimondiimarker_locus


Sequence
>NAU2835 ID=NAU2835|Name=NAU2835|organism=Gossypium raimondii|type=genetic_marker|length=183bp
GCCCGGAATTATCAGTTTTAGAGCCTATCCAATCTTTCTTGAAGAGCTGA
ATGAGTACCGAGTAGCGAATTGAGAAAGTTAAAGTTTTTTTTTTTCTAAG
TTGTTAAAACCAAAGGGGAAAAAATAAAATAATAATAATAATAATAATAA
TAATAATTAAGCGGTTTACCGTATCATCGCCAT