NAU2823

Marker Overview
NameNAU2823
Genbank IDCO081518
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(gt)7
PCR ConditionAnnealing temperature: 57
Primer 1NAU2823_F: TGGTGGTTCTTCATGTTGAC
Primer 2NAU2823_R: TCATTTCATATCAGGTACACTCG
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO081518
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr15N/AAD_chr.15142.53NAU2823View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr15N/AAD_chr.15103NAU2823View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.0189.84NAU2823-89.84View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2823_FNAU2823_FGossypium raimondiiprimer
NAU2823_RNAU2823_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2823NAU2823Gossypium raimondiimarker_locus
NAU2823NAU2823-89.84Gossypium raimondiimarker_locus


Sequence
>NAU2823 ID=NAU2823|Name=NAU2823|organism=Gossypium raimondii|type=genetic_marker|length=230bp
TGGTGGTTCTTCATGTTGACTTGTTAAGTCTGTTTTGGTAAAACGACAAG
TGGATGAAGAGCGTAATTTGAAGGTAGCAGCAGTGAGAGTAGGAGTAGGA
GAAAGCGGAGGGAAGAATAATTCAGTGAGAGGGAAAGGGGGCGATGCTAT
TGCTGTTGGTGACAATGAAATTGATGACCAAAACATTGTTTTGTGTGTGT
GTGTGTTCGAGTGTACCTGATATGAAATGA