NAU2749

Marker Overview
NameNAU2749
Genbank IDCO077782
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(ac)7
PCR ConditionAnnealing temperature: 57
Primer 1NAU2749_F: AGCGAAGTTCATACAAAACAAG
Primer 2NAU2749_R: TTATGGTGTTTTGCTGGTTG
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO077782
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr16N/AAD_chr.1624NAU2749View
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr16N/AAD_chr.1683.23NAU2749View
3H16 x T586, F2sel (2009)H16T586-F2sel_chr16N/AAD_chr.1625.3NAU2749View
4DH962 X Ji Mian 5, F2 (2015)DJiM-F2_LG49N/AAD_chr.unknown2.21NAU2749View
5CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr16N/ADt.0791.2NAU2749View
6TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr16N/AAD_chr.1657.6NAU2749-230View
7TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.1657.66NAU2749-230View
8H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.1658.1NAU2749-230View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2749_FNAU2749_FGossypium raimondiiprimer
NAU2749_RNAU2749_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2749NAU2749Gossypium raimondiimarker_locus
NAU2749-230NAU2749-230Gossypium raimondiimarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr01chromosomeNAU2749:1..782 .
Chr01:10444783..10445564 -
Chr1chromosomeNAU2749:1..782 .
Chr1:29735996..29736777 +
Sequence
>NAU2749 ID=NAU2749|Name=NAU2749|organism=Gossypium raimondii|type=genetic_marker|length=199bp
AGCGAAGTTCATACAAAACAAGCTTAGCTTTGAAATAAGAAAAATAACAC
ACACACACACAATTAATATGATCCTATGAACTAACTAAAATCACAACATC
GTACTACATTGATTCGTTCGTGGATTCATCGACATCTATTAAAATAATCT
AACCTCAGACACGTCTTTATGAACTTCATCAACCAGCAAAACACCATAA