NAU2730

Marker Overview
NameNAU2730
Genbank IDCO077067
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(aat)5
PCR ConditionAnnealing temperature: 57
Primer 1NAU2730_F: TATAAGCAAAGGGGTCAAGG
Primer 2NAU2730_R: GTACCATGGAACAGGGAAAG
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO077067
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A13N/AA_chr.1328.2NAU2730View
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr13N/AAD_chr.13131NAU2730View
3TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr13N/AAD_chr.1333.5NAU2730View
40-153 x sGK9708, RIL (2016)0s-RIL_chr18-1N/AAD_chr.1891.8NAU2730View
5SG 747 x Giza 75, BIL (2013)SG-BIL_chr13N/AAD_chr.1363.9NAU2730View
60-153 x sGK9708, RIL (2017)0s-RIL.17_chr13N/AAD_chr.13136.01NAU2730View
7TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr13N/AAD_chr.1388.9NAU2730-400View
8TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr13/A13N/AAD_chr.1389.77NAU2730-400View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2730_FNAU2730_FGossypium raimondiiprimer
NAU2730_RNAU2730_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2730NAU2730Gossypium raimondiimarker_locus
NAU2730-400NAU2730-400Gossypium raimondiimarker_locus


Sequence
>NAU2730 ID=NAU2730|Name=NAU2730|organism=Gossypium raimondii|type=genetic_marker|length=200bp
TATAAGCAAAGGGGTCAAGGACCCCTCTTTAACAAGTAAAAATGACCCAA
GTCTTATACTTTAGCTAGTTTCTGAATTATAAAACAATATCTGAAATCTA
ACAAACCAGGGCTTCAAGTTGCCCCCCGAGGAATAAAATAATAATAATAA
TTTTAACAAAAGCAAAACAAAATCTCAGGGCTTTCCCTGTTCCATGGTAC