NAU2620

Marker Overview
NameNAU2620
Genbank IDCO072582
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(ct)9
PCR ConditionAnnealing temperature: 57
Primer 1NAU2620_F: GATCAACGCCACTGAGTACA
Primer 2NAU2620_R: ATGCAGCAATTAAACACGAA
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO072582
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr16N/AAD_chr.1688NAU2620View
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr16N/AAD_chr.1679.67NAU2620View
3H16 x T586, F2sel (2009)H16T586-F2sel_chr16N/AAD_chr.1628.1NAU2620View
40-153 x sGK9708, RIL (2016)0s-RIL_chr07-1N/AAD_chr.070NAU2620View
5TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr16N/AAD_chr.1662.3NAU2620-405View
6TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.1660.89NAU2620-405View
7H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.1661NAU2620-405View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2620_FNAU2620_FGossypium raimondiiprimer
NAU2620_RNAU2620_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2620NAU2620Gossypium raimondiimarker_locus
NAU2620-405NAU2620-405Gossypium raimondiimarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr01chromosomeNAU2620:1..674 .
Chr01:11166809..11168182 +
Chr1chromosomeNAU2620:1..674 .
Chr1:29013398..29014781 -
Sequence
>NAU2620 ID=NAU2620|Name=NAU2620|organism=Gossypium raimondii|type=genetic_marker|length=237bp
GATCAACGCCACTGAGTACAATTTGCAAACGCTCGGTAATGGCTACCGAC
ATAGATAAATGTAACAGAAAACATATATATGTACAAGTTTATGCCTCTCT
CTCTCTCTCTCTGTCTAGTTTTCAACTTCCACTCTTGCAGCTATCAGTTT
TTTTTCAGACAAGTTCTCCTTTGAGTGCAGCTGCGGCTCTTTGGATGGCT
CTAGCAACTCTCCAGATTTCGTGTTTAATTGCTGCAT