CSIRO_D5chr02_1341878

Marker Overview
NameCSIRO_D5chr02_1341878
Aliasi02242Gh
Chr02_1341878
Chr02_1341877
dbSNP IDN/A
SNP Array ID
TAMU_CottonSNP63K:i02242Gh
TypeSNP
SNP AllelesC/T
5' Flanking SequenceGTTACTATCTCATACAATGCAGAATTGATATGAAGGAGAAAGTTACCTTTTTATTCAATG GCCTTGCCTTAAATTTAGGAGCTTTTTCAAGTTCCTCCTG
3' Flanking SequenceTCAAGTTCAATAGAACTTTTGACCGTTATAGGTCTTGCCCTTAGAGATGTTTGAAGCACC GGGGTTTTAGGTTCTGTGAGATGAGGTTTCCATTGAGTAT
SpeciesGossypium hirsutum
GermplasmNamcala
Sicala 40
Sicot 81
Sicala V-2
Sicot 71
Sicala 3-2
Lu Mian 14
Deltapine 90
Coker 315
Tamcot SP37
Delta Opal
Sicot 70
Sicot 189
Siokra 1-4
Riverina Paplar
Deltapine 16
VIR-6615
Source TypeRNA-seq
Publication[view all]
ContactZhu, Qian-Hao
Wilson, Iain
Stelly, David M.
CommentData obtained 2014. SNP location is based on D5 JGI 221 position
Data obtained 2014. SNP location is based on D5 JGI 221 position. In the published map, the D5-pos in the name was 1 bp diff from its exactness.
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1MCU-5 x Siokra 1-4, RIL (2015 SNP)MS-RIL_C01_LG01N/AAD_chr.0110.73Chr02_1341877View
2Phytogen 72 x Stoneville 474, consbin (2017)PS-consbin_ch01N/AAD_chr.01128.12SNPi02242GhView
33-79 x TM-1, F2 (2015 SNP)3T-F2_c01N/AAD_chr.01137.48i02242Gh-137.48View
4Phytogen 72 x Stoneville 474, F2 (2015 SNP)PS-F2_c01N/AAD_chr.01114.5i02242Gh-114.5View
Contact
NameDetails
Zhu, Qian-Hao
First name:Qian-Hao
Last name:Zhu
Title:Research Scientist
Institution:CSIRO
Address:CSIRO Plant Industry, GPO Box 1600, Canberra, ACT 2601,
Country:Australia
Email:Qianhao.Zhu@csiro.au
Phone:61 2 62464903
Last update:24-Aug-2014
Wilson, Iain
Description:SNPs; Disease resistance
First name:Iain
Last name:Wilson
Title:Senior Scientist
Institution:CSIRO
Address:Black Mountain Laboratories Clunies Ross Street, Black Mountain, ACT 2601
Country:Australia
Email:iain.wilson@csiro.au
Phone:+61 (0)2 62465211
Last update:28-Feb-2010
Stelly, David M.
Description:Integrative structural genomics; Cytogenetics; Genetics; Cytogenomics; Radiation hybrid mapping; Chromosome manipulations. ; Wide-cross introgression.; QTL definition. ; Reproductive cytology, genetics and manipulations. ; Fiber cell initiation.
First name:David
Last name:Stelly
Title:Professor
Institution:Texas A&M University
Address:370 Olsen Blvd. , Dept. Soil & Crop Sci., TAMU, College Station, TX 77843-2474
Country:United States
Email:stelly@tamu.edu
Phone:+1 979 845 2745
Fax:+1 979 845 0456
Last update:19-Feb-2007
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Chr02_1341877Chr02_1341877Gossypium hirsutummarker_locus
SNPi02242GhSNPi02242GhGossypium hirsutummarker_locus
i02242Ghi02242Gh-137.48Gossypium hirsutummarker_locus
i02242Ghi02242Gh-114.5Gossypium hirsutummarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM017701.1chromosomeCM017701.1:1703895..1704095 +
D01chromosomeD01:1304504..1304704 +
D01chromosomeD01:1492293..1492493 +
D01chromosomeD01:1467518..1467718 +
Ghir_D01chromosomeGhir_D01:1514428..1514628 +
D01chromosomeD01:1461269..1461469 +
scaffold783.1supercontigscaffold783.1:595217..595417 -
D10_01chromosomeD10_01:59102830..59103030 -
Chr8chromosomeChr8:21165646..21165846 -
D5_01chromosomeD5_01:1360871..1361070 +
Chr02chromosomeChr02:1341878..1341878 .
Germplasm
Stock NameType
Namcalacultivar
Sicala 40cultivar
Sicot 81cultivar
Sicala V-2cultivar
Sicot 71cultivar
Sicala 3-2cultivar
Lu Mian 14cultivar
Deltapine 90TBD
Coker 315TBD
Tamcot SP37TBD
Delta OpalTBD
Sicot 70TBD
Sicot 189TBD
Siokra 1-4TBD
Riverina PaplarTBD
Deltapine 16TBD
VIR-6615TBD
Sequence
>CSIRO_D5chr02_1341878 ID=CSIRO_D5chr02_1341878|Name=CSIRO_D5chr02_1341878|organism=Gossypium hirsutum|type=genetic_marker|length=205bp
GTTACTATCTCATACAATGCAGAATTGATATGAAGGAGAAAGTTACCTTT
TTATTCAATGGCCTTGCCTTAAATTTAGGAGCTTTTTCAAGTTCCTCCTG
[C/T]TCAAGTTCAATAGAACTTTTGACCGTTATAGGTCTTGCCCTTAGA
GATGTTTGAAGCACCGGGGTTTTAGGTTCTGTGAGATGAGGTTTCCATTG
AGTAT