NAU2343

Marker Overview
NameNAU2343
Genbank IDDT050030
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Xuzhou 142
Source SequenceDT050030.1
Source TypeEST
Repeat MotifGCA(8)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2343_F: GCTTTGCTTTGGAATGAGAT
Primer 2NAU2343_R: ATACTGCAACCCCTCACACT
Product Length174
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT050030
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c15N/AAD_chr.15101.54NAU2343View
2(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr24N/AAD_chr.2447.7NAU2343View
3TM-1 x 3-79, RIL (2014)T3-RIL.14_chr15N/AAD_chr.1518.4NAU2343View
4GX1135 x GX100-2, F2 (2013)GG-F2_chr01N/AAD_chr.01148.5NAU2343View
5GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-1N/AAD_chr.01161.3NAU2343View
60-153 x sGK9708, RIL (2016)0s-RIL_chr15-2N/AAD_chr.1567.1NAU2343View
7CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr15N/ADt.0141.9NAU2343View
8CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr15N/AAD_chr.15115NAU2343View
90-153 x sGK9708, RIL (2017)0s-RIL.17_chr15N/AAD_chr.1574.41NAU2343View
10CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.01105.66NAU2343-105.655View
11TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.15N/AAD_chr.1518.36NAU2343-18.358View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2343_FNAU2343_FGossypium hirsutumprimer
NAU2343_RNAU2343_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber strengthqFS.GG-F2_ch01.hd08Gossypium hirsutumQTL
verticillium wilt disease severityqVWDS.0s-RIL.17_ch15.ay15Gossypium hirsutumQTL
verticillium wilt disease incidenceqVWDI.0s-RIL.17_ch15.aygh.2Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2343NAU2343Gossypium hirsutummarker_locus
NAU2343NAU2343-105.655Gossypium hirsutummarker_locus
NAU2343NAU2343-18.358Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT050030.1DT050030.1Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
Xuzhou 142cultivar
Xuzhou 142cultivar
Sequence
>NAU2343 ID=NAU2343|Name=NAU2343|organism=Gossypium hirsutum|type=genetic_marker|length=174bp
GCTTTGCTTTGGAATGAGATTGTAAAGCATTTTCAGAGCCAAATGATCTG
CCACAGGACTTGCAAGGGAATGAACCACCGGACTTTGGAGTCTGCTTCAC
CTGTGCAGCAGCAGCAGCAGCAGCAGCAGCTGATGTTTTCCCAGCCTTTT
TGGAAGTGTGAGGGGTTGCAGTAT