CSIRO_D5chr02_8461788

Marker Overview
NameCSIRO_D5chr02_8461788
AliasChr02_8461788
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
5' Flanking SequenceTCAAGATCACCATTTGTGGTGTTGTTCCTAGTTGTCCTGCATGATGGAGCTTCTTCATTC CATATCAAAGATGCCGGGAATTCCTTTGAATCAATTTTCA
3' Flanking SequenceTGGTTTGGTAGTATCGGGGGAGTCCATTCTTGATGGCCTTGGTTTAACATAGTTTTTCCC TATCAGACTGGAAACACTGCCCATTGATACAGAACCTCTT
SpeciesGossypium hirsutum
GermplasmSiokra 1-4
VIR-6615
Source Typerestriction-site associated DNA
RNA-seq and restriction-site associated DNA
Restriction EnzymeEcoRI; ApekI; SbfI
Publication[view all]
ContactZhu, Qian-Hao
Wilson, Iain
CommentData obtained 2014. SNP location is based on D5 JGI 221 position
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1MCU-5 x Siokra 1-4, RIL (2015 SNP)MS-RIL_C01_LG01N/AAD_chr.0172.16Chr02_8461788View
Contact
NameDetails
Zhu, Qian-Hao
First name:Qian-Hao
Last name:Zhu
Title:Research Scientist
Institution:CSIRO
Address:CSIRO Plant Industry, GPO Box 1600, Canberra, ACT 2601,
Country:Australia
Email:Qianhao.Zhu@csiro.au
Phone:61 2 62464903
Last update:24-Aug-2014
Wilson, Iain
Description:SNPs; Disease resistance
First name:Iain
Last name:Wilson
Title:Senior Scientist
Institution:CSIRO
Address:Black Mountain Laboratories Clunies Ross Street, Black Mountain, ACT 2601
Country:Australia
Email:iain.wilson@csiro.au
Phone:+61 (0)2 62465211
Last update:28-Feb-2010
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Chr02_8461788Chr02_8461788Gossypium hirsutummarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM017701.1chromosomeCM017701.1:7257945..7258145 +
CM017649.1chromosomeCM017649.1:7911700..7911900 +
CM017623.1chromosomeCM017623.1:7093321..7093521 +
D01chromosomeD01:7357988..7358188 +
Gbar_D01chromosomeGbar_D01:7624136..7624336 +
D01chromosomeD01:7198135..7198335 +
D01chromosomeD01:6761200..6761400 +
D01chromosomeD01:7163309..7163509 +
Ghir_D01chromosomeGhir_D01:7329233..7329433 +
scaffold130481supercontigscaffold130481:89..289 -
A01chromosomeA01:7720223..7720423 +
D01chromosomeD01:6174083..6174283 +
At_chr2chromosomeAt_chr2:4796742..4796942 +
At_chr2chromosomeAt_chr2:8458123..8458323 +
D10_01chromosomeD10_01:53808619..53808819 -
scaffold349supercontigscaffold349:154627..154827 +
D5_01chromosomeD5_01:6488779..6488978 +
CM018215.1chromosomeCM018215.1:6904996..6905196 +
Germplasm
Stock NameType
Siokra 1-4TBD
VIR-6615TBD
Sequence
>CSIRO_D5chr02_8461788 ID=CSIRO_D5chr02_8461788|Name=CSIRO_D5chr02_8461788|organism=Gossypium hirsutum|type=genetic_marker|length=205bp
TCAAGATCACCATTTGTGGTGTTGTTCCTAGTTGTCCTGCATGATGGAGC
TTCTTCATTCCATATCAAAGATGCCGGGAATTCCTTTGAATCAATTTTCA
[C/G]TGGTTTGGTAGTATCGGGGGAGTCCATTCTTGATGGCCTTGGTTT
AACATAGTTTTTCCCTATCAGACTGGAAACACTGCCCATTGATACAGAAC
CTCTT