NAU2296

Marker Overview
NameNAU2296
Genbank IDDT049131
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Xuzhou 142
Source SequenceDT049131.1
Source TypeEST
Repeat MotifCTG(10)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2296_F: TATGCAAACAAACTGCTGCT
Primer 2NAU2296_R: GTGCTGTGTCGTGTAGGTGT
Product Length117
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT049131
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Hai-7124 x Junmian-1, F2 (2008) partHai-7124 x Junmian-1, F2 (2008) part.HJ-F2_chr05N/AAD_chr.05133.7NAU2296View
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.05202NAU2296View
3TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c05N/AAD_chr.05126.36NAU2296View
4TM-1 x 3-79, RIL (2014)T3-RIL.14_chr05N/AAD_chr.0574.3NAU2296View
5TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr05N/AAD_chr.05148.1NAU2296-110View
6TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr05/A5N/AAD_chr.05136.31NAU2296-110View
7TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.05N/AAD_chr.0574.31NAU2296-74.314View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2296_FNAU2296_FGossypium hirsutumprimer
NAU2296_RNAU2296_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2296NAU2296Gossypium hirsutummarker_locus
NAU2296-110NAU2296-110Gossypium hirsutummarker_locus
NAU2296NAU2296-74.314Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT049131.1DT049131.1Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
Xuzhou 142cultivar
Xuzhou 142cultivar
Sequence
>NAU2296 ID=NAU2296|Name=NAU2296|organism=Gossypium hirsutum|type=genetic_marker|length=117bp
TATGCAAACAAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCAGTATTA
TGTCATCTTTATCATCAATGATACCAACAATGTTTGCTTCTACAAGAACA
CCTACACGACACAGCAC