NAU2291

Marker Overview
NameNAU2291
AliasNAU0913=NAU2291
Genbank IDDT049088
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Xuzhou 142
Source TypeEST
Repeat MotifAT(9)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2291_F: CCCATGATCAAAAGACAACA
Primer 2NAU2291_R: GCTTAAAGATCGAGGACGAA
Product Length208
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT049088
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr22N/AAD_chr.2257.16NAU2291View
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c22N/AAD_chr.2222.47NAU2291View
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c04N/AAD_chr.0420.92NAU2291View
4Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch22N/AAD_chr.2222.68NAU2291View
5Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch04N/AAD_chr.0416.93NAU2291View
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr22N/AAD_chr.2215NAU2291View
7Yumian-1 x T586, RIL (2006)YT-RIL_chr17-4N/AAD_chr.1720.5NAU2291View
8Yumian-1 x 7235, RIL (2015)Y7-RIL_chr04N/AAD_chr.0455.1NAU2291View
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr22N/ADt.0438.9NAU2291View
10CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr04N/AAD_chr.0431.4NAU2291View
11TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c04N/AAD_chr.0475.38NAU2291aView
12Yumian-1 x T586, RIL (2015)YT-RIL.15_chr04N/AAD_chr.0457.8NAU2291aView
13TM-1 x 3-79, RIL (2014)T3-RIL.14_chr04N/AAD_chr.0476.5NAU2291aView
14TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c22N/AAD_chr.2249.3NAU2291bView
15Yumian-1 x T586, RIL (2015)YT-RIL.15_chr22N/AAD_chr.2268NAU2291bView
16TM-1 x 3-79, RIL (2014)T3-RIL.14_chr22N/AAD_chr.2281.8NAU2291bView
17TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr22N/AAD_chr.2229.4NAU2291-250View
18TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr22/D4N/AAD_chr.2292.48NAU2291-250View
19CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr04N/AAt.0484.88NAU2291-84.884View
20TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.04N/AAD_chr.0476.34NAU2291a-76.337View
21TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.22N/AAD_chr.2281.83NAU2291b-81.829View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2291_FNAU2291_FGossypium hirsutumprimer
NAU2291_RNAU2291_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2291NAU2291Gossypium hirsutummarker_locus
NAU2291aNAU2291aGossypium hirsutummarker_locus
NAU2291bNAU2291bGossypium hirsutummarker_locus
NAU2291-250NAU2291-250Gossypium hirsutummarker_locus
NAU2291NAU2291-84.884Gossypium hirsutummarker_locus
NAU2291aNAU2291a-76.337Gossypium hirsutummarker_locus
NAU2291bNAU2291b-81.829Gossypium hirsutummarker_locus


Germplasm
Stock NameType
Xuzhou 142cultivar
Xuzhou 142cultivar