NAU2265

Marker Overview
NameNAU2265
Genbank IDDT048657
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Xuzhou 142
Source SequenceDT048657.1
Source TypeEST
Repeat MotifACAT(10)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2265_F: CAATCACATTGATGCCAACT
Primer 2NAU2265_R: CGGTTAAGCTTCCAGACATT
Product Length224
PolymorphismP_ NAU2265
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT048657
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c02N/AAD_chr.0299.44NAU2265View
2Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch02N/AAD_chr.0274.96NAU2265View
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr02N/AAD_chr.027NAU2265View
4Yumian-1 x T586, RIL (2006)YT-RIL_chr02-2N/AAD_chr.0286.8NAU2265View
5(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr02-1N/AAD_chr.020NAU2265View
6Yumian-1 x T586, RIL (2015)YT-RIL.15_chr02N/AAD_chr.02136.9NAU2265View
7Prema x 86-1, RIL (2015)P8-RIL_chr02.2N/AAD_chr.024.04NAU2265View
8Yumian-1 x 7235, RIL (2015)Y7-RIL_chr02N/AAD_chr.0299.6NAU2265View
9GX1135 x GX100-2, F2 (2013)GG-F2_chr02-4N/AAD_chr.020NAU2265View
10GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr04-1N/AAD_chr.04129.2NAU2265View
110-153 x sGK9708, RIL (2016)0s-RIL_chr02-3N/AAD_chr.0259.6NAU2265View
12CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr02N/AAt.02175.6NAU2265View
13CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr02N/AAD_chr.021.3NAU2265View
140-153 x sGK9708, RIL (2017)0s-RIL.17_chr02N/AAD_chr.023.82NAU2265View
15TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c02N/AAD_chr.023.67NAU2265aView
16TM-1 x 3-79, RIL (2014)T3-RIL.14_chr02N/AAD_chr.023.7NAU2265aView
17TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c14N/AAD_chr.140.32NAU2265bView
18TM-1 x 3-79, RIL (2014)T3-RIL.14_chr14N/AAD_chr.14126.1NAU2265bView
19TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr02N/AAD_chr.025.4NAU2265-380View
20TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr02/A2N/AAD_chr.02109.46NAU2265-380View
21Yumian-1 x T586, RIL (2009)YT-RIL_chr02-1N/AAD_chr.026.4NAU2265/210t(C2)View
22CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr02N/AAt.02119.4NAU2265-119.4View
23TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.02N/AAD_chr.023.66NAU2265a-3.664View
24TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.14N/AAD_chr.14126.1NAU2265b-126.097View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2265_FNAU2265_FGossypium hirsutumprimer
NAU2265_RNAU2265_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber uniformityqFU.YCY7-4WC_chr02-1.bb09Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2265NAU2265Gossypium hirsutummarker_locus
NAU2265aNAU2265aGossypium hirsutummarker_locus
NAU2265bNAU2265bGossypium hirsutummarker_locus
NAU2265-380NAU2265-380Gossypium hirsutummarker_locus
NAU2265/210t(C2)NAU2265/210t(C2)Gossypium hirsutummarker_locus
NAU2265NAU2265-119.4Gossypium hirsutummarker_locus
NAU2265aNAU2265a-3.664Gossypium hirsutummarker_locus
NAU2265bNAU2265b-126.097Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT048657.1DT048657.1Gossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr03chromosomeNAU2265:4..550 .
Chr03:302127..302653 +
Chr3chromosomeNAU2265:4..550 .
Chr3:25607876..25608402 +
Germplasm
Stock NameType
Xuzhou 142cultivar
Xuzhou 142cultivar
Sequence
>NAU2265 ID=NAU2265|Name=NAU2265|organism=Gossypium hirsutum|type=genetic_marker|length=224bp
CAATCACATTGATGCCAACTGAACGAGNCACATGATGCACACTTCACACA
CATGTACACACTTGCACAGACATACATACATACATACATACATACATACA
TACATACATACAACGACGCACATTTTTTGCAAACTAATGCCTCAACAAAG
AACTAAGAACAGAAGAAATCTGCAATGGGTACACATGGTGATTTACGTCG
TAAGAATGTCTGGAAGCTTAACCG