NAU2152

Marker Overview
NameNAU2152
Genbank IDDT046853
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Xuzhou 142
Source SequenceDT046853.1
Source TypeEST
Repeat MotifAT(7); ATA(7)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2152_F: GAAAACAAGGCACTTGAACC
Primer 2NAU2152_R: GATCGATCAAAACCGGTAAC
Product Length198
PolymorphismP_ NAU2152
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT046853
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr11N/AAD_chr.1138.7NAU2152View
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c11N/AAD_chr.1137.22NAU2152View
3Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch11/lgA03N/AAD_chr.112.14NAU2152View
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr11N/AAD_chr.11181NAU2152View
5AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr17N/AAD_chr.1752NAU2152View
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr16N/AAD_chr.169NAU2152View
7IL138-A11-3 x TM-1, F2:3 (2014)ILTM-F2:3_chr11N/AAD_chr.110NAU2152View
8TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr06N/AAD_chr.060NAU2152View
9GX1135 x GX100-2, F2 (2013)GG-F2_chr11-3N/AAD_chr.1122.3NAU2152View
10GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr11N/AAD_chr.113.8NAU2152View
11(86-1 x G. anomalum) x Su8289, BC2F1 (2015)8S-BC2F1_chr11N/AB_chr.1135NAU2152View
12CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr11N/AAt.11229.4NAU2152View
13TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c11N/AAD_chr.11141.61NAU2152aView
14TM-1 x 3-79, RIL (2014)T3-RIL.14_chr11N/AAD_chr.11144.8NAU2152aView
15TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c21N/AAD_chr.21116.09NAU2152bView
16TM-1 x 3-79, RIL (2014)T3-RIL.14_chr21N/AAD_chr.21128NAU2152bView
17TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr11N/AAD_chr.1125.5NAU2152-210View
18TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr11/A11N/AAD_chr.1125.51NAU2152-210View
19TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr16N/AAD_chr.1628.8NAU2152-170View
20TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.1628.63NAU2152-170View
21H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.1628.6NAU2152-170View
22TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr17N/AAD_chr.1779.6NAU2152-230View
23TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr17/D3N/AAD_chr.1738.46NAU2152-230View
24GB713 x Nem-X, F2 (2011)GN-F2_chr21N/AAD_chr.21189.3NAU2152_224View
25TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.11N/AAD_chr.11144.81NAU2152a-144.806View
26TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.21N/AAD_chr.21128NAU2152b-127.999View
27PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr11N/AAt.116.4NAU2152b-6.4View
28PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr21N/ADt.115.7NAU2152a-5.7View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2152_FNAU2152_FGossypium hirsutumprimer
NAU2152_RNAU2152_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2152NAU2152Gossypium hirsutummarker_locus
NAU2152aNAU2152aGossypium hirsutummarker_locus
NAU2152bNAU2152bGossypium hirsutummarker_locus
NAU2152-210NAU2152-210Gossypium hirsutummarker_locus
NAU2152-170NAU2152-170Gossypium hirsutummarker_locus
NAU2152-230NAU2152-230Gossypium hirsutummarker_locus
NAU2152_224NAU2152_224Gossypium hirsutummarker_locus
NAU2152aNAU2152a-144.806Gossypium hirsutummarker_locus
NAU2152bNAU2152b-127.999Gossypium hirsutummarker_locus
NAU2152bNAU2152b-6.4Gossypium hirsutummarker_locus
NAU2152aNAU2152a-5.7Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT046853.1DT046853.1Gossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM017698.1chromosomeCM017698.1:109654237..109654434 +
CM017711.1chromosomeCM017711.1:64847365..64847593 +
CM017646.1chromosomeCM017646.1:122252542..122252743 -
CM017659.1chromosomeCM017659.1:69299882..69300108 +
CM017620.1chromosomeCM017620.1:115933212..115933407 +
CM017633.1chromosomeCM017633.1:66864296..66864518 +
A11chromosomeA11:112008667..112008870 +
D11chromosomeD11:67741499..67741721 +
Gbar_A11chromosomeGbar_A11:108738394..108738597 +
Gbar_D11chromosomeGbar_D11:64907222..64907446 +
scaffold28009supercontigscaffold28009:14765..14989 -
scaffold28009supercontigscaffold28009:19197..19421 -
scaffold16644supercontigscaffold16644:123231..123434 +
At11chromosomeAt11:93132657..93132860 +
D11chromosomeD11:65237406..65237628 -
A11chromosomeA11:111696831..111697028 +
A11chromosomeA11:115025174..115025371 +
D11chromosomeD11:68153055..68153279 +
A11chromosomeA11:117178358..117178555 +
D11chromosomeD11:66956705..66956927 +
Ghir_A11chromosomeGhir_A11:118809408..118809605 +
Ghir_D11chromosomeGhir_D11:68670739..68670961 +
A11chromosomeA11:88794811..88795008 +
D11chromosomeD11:61712786..61713008 +
At_chr1chromosomeAt_chr1:3847152..3847349 -
scaffold1984.1supercontigscaffold1984.1:319460..319684 +
CM016624.1chromosomeCM016624.1:138863822..138864028 +
D10_11chromosomeD10_11:65053509..65053736 -
Chr7chromosomeChr7:4520428..4520650 -
Chr11_CRI-A2_v1.0.a1chromosomeChr11_CRI-A2_v1.0.a1:5341780..5341999 -
Chr12chromosomeChr12:97076415..97076634 +
KI_11chromosomeKI_11:52359830..52360034 +
D5_11chromosomeD5_11:3796731..3796953 -
CM018212.1chromosomeCM018212.1:109152324..109152527 -
A11chromosomeA11:109886330..109886527 +
D11chromosomeD11:68772351..68772573 +
Germplasm
Stock NameType
Xuzhou 142cultivar
Xuzhou 142cultivar
Sequence
>NAU2152 ID=NAU2152|Name=NAU2152|organism=Gossypium hirsutum|type=genetic_marker|length=198bp
GAAAACAAGGCACTTGAACCACATTAGAATCAATATAACTCATATATATA
TATATAACCTACAAAACAATATACAGTTCACATTAATGGTAAAAAGAAGA
CCAGATTTTCATGACTCAACAGTGATGTTTCCGTTACTCGGCTTCGTGAT
TTTCGGAGCAGCAGCTTTCATTGTTGTCGTTACCGGTTTTGATCGATC