NAU2026

Marker Overview
NameNAU2026
Genbank IDDR044147
TypeSSR
SpeciesGossypium hirsutum
Germplasm7235
7235
Source SequenceDR044147.1
Source TypeEST
Repeat MotifCAG(4); GGA(4)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2026_F: GAATCTCGAAAACCCCATCT
Primer 2NAU2026_R: ATTTGGAAGCGAAGTACCAG
Product Length199
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDR044147
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_D04-1N/AAD_chr.220NAU2026View
27235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_D06-1N/AAD_chr.25147NAU2026View
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr22N/AAD_chr.2231NAU2026View
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr25N/AAD_chr.25201NAU2026View
5Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch22/D04N/AAD_chr.2266.9NAU2026View
6Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A12N/AA_chr.12206.9NAU2026View
7Yumian-1 x T586, RIL (2006)YT-RIL_chr22N/AAD_chr.2253.4NAU2026View
8(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr22-1N/AAD_chr.2239.9NAU2026View
9Yumian-1 x T586, RIL (2015)YT-RIL.15_chr22N/AAD_chr.2228.8NAU2026View
10Prema x 86-1, RIL (2015)P8-RIL_chr22.3N/AAD_chr.2266.75NAU2026View
11Yumian-1 x 7235, RIL (2015)Y7-RIL_chr22N/AAD_chr.2241.5NAU2026View
12W10 x TM-1, F2:3 (2015)WT-F2:3_chr22N/AAD_chr.2275.2NAU2026View
13GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr22N/AAD_chr.2275.2NAU2026View
14GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr22-1N/AAD_chr.221.6NAU2026View
15CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr22N/ADt.04102.4NAU2026View
16CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr22N/AAD_chr.2272.2NAU2026View
17Yumian-1 x T586, RIL (2009)YT-RIL_chr22N/AAD_chr.2248.3NAU2026/170tView
18CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr22N/ADt.0439.38NAU2026-39.382View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2026_FNAU2026_FGossypium hirsutumprimer
NAU2026_RNAU2026_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
lint percentqLP.7T-ch25.e1Gossypium hirsutumQTL
lint percentqLP.7T-ch25.e2Gossypium hirsutumQTL
lint percentqLP.7T-ch25.e3Gossypium hirsutumQTL
lint percentqLP.7T-ch25.e4Gossypium hirsutumQTL
seed indexqSI.7T-ch25.e1Gossypium hirsutumQTL
seed indexqSI.7T-ch25.e2Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2026NAU2026Gossypium hirsutummarker_locus
NAU2026/170tNAU2026/170tGossypium hirsutummarker_locus
NAU2026NAU2026-39.382Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DR044147.1DR044147.1Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
7235TBD
7235TBD
Sequence
>NAU2026 ID=NAU2026|Name=NAU2026|organism=Gossypium hirsutum|type=genetic_marker|length=199bp
GAATCTCGAAAACCCCATCTGAGATAGAACAAAAGAAAAGGAAAAAAGAA
ATGTCGCCGCCAGCAGCAGCAGCGGTAGCGGCAGCGGCAGCGGGCGGAGG
AGGAGGACAGNCTCAGCGGCAGCAGCAACAAGGTGGATTTTGGACAGAGC
ATAACCGGAATCATAAGGATCGCCGTCTTCTGGTACTTCGCTTCCAAAT