NAU2016

Marker Overview
NameNAU2016
AliasNAU2063
NAU2016=NAU2063
Genbank IDDR044137
TypeSSR
SpeciesGossypium hirsutum
Germplasm7235
7235
Source SequenceDR044137.1
Source TypeEST
Repeat MotifTC(11); TCT(4)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2016_F: AGCATTTCTCCAAGACTCCA
Primer 2NAU2016_R: CAGAGAAAAGGGACAGAGGA
Product Length235
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDR044137
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr11N/AAD_chr.1122.99NAU2016bView
2TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c21N/AAD_chr.21120.7NAU2016bView
3TM-1 x 3-79, RIL (2014)T3-RIL.14_chr21N/AAD_chr.21131.8NAU2016bView
4Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr21N/AAD_chr.21225.62NAU2016aView
5TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c11N/AAD_chr.11146.95NAU2016aView
6TM-1 x 3-79, RIL (2014)T3-RIL.14_chr11N/AAD_chr.11149.9NAU2016aView
7AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr11N/AAD_chr.11174nau2016View
8AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr21N/AAD_chr.217nau2016View
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr11N/AAt.11208.5nau2016View
10CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr21N/AAD_chr.21122.8nau2016View
11TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr11N/AAD_chr.1118.1NAU2016-250View
12TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr11/A11N/AAD_chr.1118.13NAU2016-250View
13TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr21N/AAD_chr.2118.5NAU2016-200View
14TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr21/D11N/AAD_chr.2115.27NAU2016-200View
15CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr21N/ADt.11142.31NAU2016-142.307View
16TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.11N/AAD_chr.11149.87NAU2016a-149.866View
17TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.21N/AAD_chr.21131.77NAU2016b-131.774View
18PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr11N/AAt.111.7NAU2016-1.7View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2016_FNAU2016_FGossypium hirsutumprimer
NAU2016_RNAU2016_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2016bNAU2016bGossypium hirsutummarker_locus
NAU2016aNAU2016aGossypium hirsutummarker_locus
nau2016nau2016Gossypium hirsutummarker_locus
NAU2016-250NAU2016-250Gossypium hirsutummarker_locus
NAU2016-200NAU2016-200Gossypium hirsutummarker_locus
NAU2016NAU2016-142.307Gossypium hirsutummarker_locus
NAU2016aNAU2016a-149.866Gossypium hirsutummarker_locus
NAU2016bNAU2016b-131.774Gossypium hirsutummarker_locus
NAU2016NAU2016-1.7Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DR044137.1DR044137.1Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
7235TBD
7235TBD
Sequence
>NAU2016 ID=NAU2016|Name=NAU2016|organism=Gossypium hirsutum|type=genetic_marker|length=235bp
AGCATTTCTCCAAGACTCCAAAAATCAACCCAANACANCCCCATTTGCAG
ATTCCTCTTCTTCTTCTTNGTCTTTGTCTTCATCTTCTTCATCATTTCTG
TGTTTANCCCANAAATTTGCAGCTACTTCAGCTAATAACAGAAGCTCAAC
AATCTCTCTCTCTCTCTCTCTCTCTTTTTAACACCATGTTCACTTGTTAT
TAGAAAGCTTTCAACTCCTCTGTCCCTTTTCTCTG